• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Agrimonia Pilosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTGACCTGCCCGGCAGAACGACCCGAGAACACGTTTCGACGCTCGGGGACGGAGGGGGCCCTCGCGGCCGCCCCGTCCCCGCATCCCGGGAGGCGAGGGCCTTTGACGCGTGTCGCGCTCCGGCGCTTCCGCCCGGCCGAGCCTCCCGGGCGTACCGAACACCGGCGTGAATTGCGCCAAGGAACCTGAACGAAAGGGCGTCGCCCCCCCCCCCCGCCGTGCCGGAGACGGTGTCCGTGCGGGCGGGCCGCGTCGTCTTCGATATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGTCGTTGCCCCGCCCCGACACGTCCTCTCGTAAAAGGGAGGGGGGTCGGGACGGGACGGATGATGGCCTCCCGTGTGCCCCGTCACGCGGCCGGCATAAACACAGGGTCCCCGGCGGCCAGCGCCTCGACGATCGGTGGTTGTCTAGACCTCGGTTTCTTGTCGTGCGCGGGCGTCGTCGTGGGGGCTTCCCGATGCGCGTCGGTTCCGGCGCTCCCAACGCGACCCCAG

Click for details-----ITS1

TCGTGACCTGCCCGGCAGAACGACCCGAGAACACGTTTCGACGCTCGGGGACGGAGGGGGCCCTCGCGGCCGCCCCGTCCCCGCATCCCGGGAGGCGAGGGCCTTTGACGCGTGTCGCGCTCCGGCGCTTCCGCCCGGCCGAGCCTCCCGGGCGTACCGAACACCGGCGTGAATTGCGCCAAGGAACCTGAACGAAAGGGCGTCGCCCCCCCCCCCCGCCGTGCCGGAGACGGTGTCCGTGCGGGCGGGCCGCGTCGTCTTCGATATGTCTAAA

Click for details-----ITS2

GTCGTTGCCCCGCCCCGACACGTCCTCTCGTAAAAGGGAGGGGGGTCGGGACGGGACGGATGATGGCCTCCCGTGTGCCCCGTCACGCGGCCGGCATAAACACAGGGTCCCCGGCGGCCAGCGCCTCGACGATCGGTGGTTGTCTAGACCTCGGTTTCTTGTCGTGCGCGGGCGTCGTCGTGGGGGCTTCCCGATGCGCGTCGGTTCCGGCGCTCCCAACGCGACCCCAG
Taxonomic Information

Plant ID: NPO18007
Plant Latin Name: Agrimonia Pilosa
Taxonomy Genus: Agrimonia
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 74656
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; South Korea; India; Russia

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Analgesic; Antibacterial; Antiinflammatory; Antipyretic; Astringent; Cardiotonic; Haemostatic; Hypoglycaemic; Vasoconstrictor; Vermifuge

Geographical Distribution

India; South Korea; China; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

206 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


133 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

105 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC9880

Ingredient ID: NPC98204

Ingredient ID: NPC96630

Ingredient ID: NPC96286

Ingredient ID: NPC94118

Ingredient ID: NPC89069

Ingredient ID: NPC88789

Ingredient ID: NPC87828

Ingredient ID: NPC85813

Ingredient ID: NPC85550

Ingredient ID: NPC84030

Ingredient ID: NPC82115

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC73577

Ingredient ID: NPC71074

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC66681

Ingredient ID: NPC61477

Ingredient ID: NPC60556

Ingredient ID: NPC58478

Ingredient ID: NPC56023

Ingredient ID: NPC5515

Ingredient ID: NPC53720

Ingredient ID: NPC52230

Ingredient ID: NPC51758

Ingredient ID: NPC51700

Ingredient ID: NPC51189

Ingredient ID: NPC50898

Ingredient ID: NPC479794

Ingredient ID: NPC479793

Ingredient ID: NPC47946

Ingredient ID: NPC47521

Ingredient ID: NPC46380

Ingredient ID: NPC46330

Ingredient ID: NPC45603

Ingredient ID: NPC43114

Ingredient ID: NPC424

Ingredient ID: NPC39633

Ingredient ID: NPC38751

Ingredient ID: NPC36835

Ingredient ID: NPC36653

Ingredient ID: NPC36061

Ingredient ID: NPC35519

Ingredient ID: NPC34764

Ingredient ID: NPC34440

Ingredient ID: NPC324696

Ingredient ID: NPC323434

Ingredient ID: NPC322655

Ingredient ID: NPC32222

Ingredient ID: NPC321036

Ingredient ID: NPC320283

Ingredient ID: NPC319108

Ingredient ID: NPC318533

Ingredient ID: NPC317111

Ingredient ID: NPC3155

Ingredient ID: NPC311816

Ingredient ID: NPC310478

Ingredient ID: NPC309182

Ingredient ID: NPC308218

Ingredient ID: NPC306990

Ingredient ID: NPC306207

Ingredient ID: NPC301585

Ingredient ID: NPC300649

Ingredient ID: NPC297643

Ingredient ID: NPC297222

Ingredient ID: NPC294902

Ingredient ID: NPC290437

Ingredient ID: NPC290189

Ingredient ID: NPC288932

Ingredient ID: NPC288645

Ingredient ID: NPC288537

Ingredient ID: NPC287550

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC281131

Ingredient ID: NPC280965

Ingredient ID: NPC279121

Ingredient ID: NPC275463

Ingredient ID: NPC272902

Ingredient ID: NPC271087

Ingredient ID: NPC26974

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC268469

Ingredient ID: NPC26600

Ingredient ID: NPC265636

Ingredient ID: NPC264779

Ingredient ID: NPC264711

Ingredient ID: NPC264207

Ingredient ID: NPC263542

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC260619

Ingredient ID: NPC259733

Ingredient ID: NPC255662

Ingredient ID: NPC255042

Ingredient ID: NPC252257

Ingredient ID: NPC249009

Ingredient ID: NPC248726

Ingredient ID: NPC247835

Ingredient ID: NPC246543

Ingredient ID: NPC246162

Ingredient ID: NPC243337

Ingredient ID: NPC240817

Ingredient ID: NPC237837

Ingredient ID: NPC235021

Ingredient ID: NPC233533

Ingredient ID: NPC231738

Ingredient ID: NPC229262

Ingredient ID: NPC227378

Ingredient ID: NPC22708

Ingredient ID: NPC225710

Ingredient ID: NPC2251

Ingredient ID: NPC223468

Ingredient ID: NPC223148

Ingredient ID: NPC222065

Ingredient ID: NPC219876

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC214067

Ingredient ID: NPC21372

Ingredient ID: NPC209970

Ingredient ID: NPC209846

Ingredient ID: NPC209275

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC206050

Ingredient ID: NPC20306

Ingredient ID: NPC201844

Ingredient ID: NPC196490

Ingredient ID: NPC194206

Ingredient ID: NPC193180

Ingredient ID: NPC192962

Ingredient ID: NPC19240

Ingredient ID: NPC190810

Ingredient ID: NPC190043

Ingredient ID: NPC189853

Ingredient ID: NPC189142

Ingredient ID: NPC189036

Ingredient ID: NPC187602

Ingredient ID: NPC187061

Ingredient ID: NPC184049

Ingredient ID: NPC184028

Ingredient ID: NPC183811

Ingredient ID: NPC182840

Ingredient ID: NPC182102

Ingredient ID: NPC18208

Ingredient ID: NPC180871

Ingredient ID: NPC180840

Ingredient ID: NPC180684

Ingredient ID: NPC179950

Ingredient ID: NPC179024

Ingredient ID: NPC178223

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC176309

Ingredient ID: NPC175987

Ingredient ID: NPC174490

Ingredient ID: NPC173637

Ingredient ID: NPC167385

Ingredient ID: NPC166894

Ingredient ID: NPC16157

Ingredient ID: NPC160601

Ingredient ID: NPC160156

Ingredient ID: NPC15970

Ingredient ID: NPC157781

Ingredient ID: NPC15658

Ingredient ID: NPC155182

Ingredient ID: NPC154186

Ingredient ID: NPC147343

Ingredient ID: NPC14682

Ingredient ID: NPC146197

Ingredient ID: NPC14576

Ingredient ID: NPC144023

Ingredient ID: NPC143639

Ingredient ID: NPC142415

Ingredient ID: NPC142252

Ingredient ID: NPC139546

Ingredient ID: NPC139545

Ingredient ID: NPC139029

Ingredient ID: NPC138347

Ingredient ID: NPC13789

Ingredient ID: NPC136091

Ingredient ID: NPC135391

Ingredient ID: NPC135088

Ingredient ID: NPC133671

Ingredient ID: NPC132142

Ingredient ID: NPC131809

Ingredient ID: NPC126240

Ingredient ID: NPC124876

Ingredient ID: NPC120926

Ingredient ID: NPC117493

Ingredient ID: NPC116775

Ingredient ID: NPC109945

Ingredient ID: NPC109813

Ingredient ID: NPC106250

Ingredient ID: NPC105557

Ingredient ID: NPC104569

Ingredient ID: NPC10251

Ingredient ID: NPC101285