CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Styrax Japonicus

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCAAAACCTGCAAGGCAGTATGACCCGTGAACCCGTACACCAACCTGGGGAGGCAGGGGAGGTGGGCGTTGGTCCCCTTCCTCTGTTTCCTCTCTGTTCGGGCATTGTTCTGAGCCCTCTCATAGGTGTGATGATGCGGTCCCCGGCCTAACAACGAACCCCGGCGCGAACCGCGCCAAGGAAGTTTGAACAAGAGAGTGCGACCCCGGGCCCCCGATTTGCGGGGGTGCCAAGGGGTAGCGTGCCTTTCATGAAATAAGAAATTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAACCATTAGGTTGAGGGCACGCCTGCCTGGGCGTCTCACATCACCCTGTGCCCTCCCAGAACTCCTTTTGGCGTCTGGTGTTTGGGGCGTGGTATATTGGCCCCCCGTGCTCTATGGAGTGCGGTCGGCCTAAAATGACGCACATGACATCTGTCGACACAGAACAGTGGTTGGCGATTAGTCGTTACTATCCTGTGGTGTCGCTTGCGGTGTCGGTTGTTTTGTAGACCCAGAGTGCCGTTGCAACGGTGCCTTGG

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO17951
Plant Latin Name: Styrax Japonicus
Taxonomy Genus: Styrax
Taxonomy Family: Styracaceae

Plant External Links:

NCBI TaxonomyDB: 59680
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

South Korea; Mexico

Traditional Medicine System:

Geographical Distribution

South Korea; Mexico

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

27 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

15 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99968

Ingredient ID: NPC94256

Ingredient ID: NPC66130

Ingredient ID: NPC61604

Ingredient ID: NPC51700

Ingredient ID: NPC306675

Ingredient ID: NPC28913

Ingredient ID: NPC287429

Ingredient ID: NPC286099

Ingredient ID: NPC254607

Ingredient ID: NPC245853

Ingredient ID: NPC245615

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC236709

Ingredient ID: NPC230301

Ingredient ID: NPC202062

Ingredient ID: NPC195334

Ingredient ID: NPC1896

Ingredient ID: NPC186316

Ingredient ID: NPC175313

Ingredient ID: NPC158635

Ingredient ID: NPC135370

Ingredient ID: NPC13318

Ingredient ID: NPC129206

Ingredient ID: NPC115466

Ingredient ID: NPC109955

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	4

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04649203	Cytoflavin in the Treatment of Patients With Diabetic Polyneuropathy	diabetic neuropathy	Succinic Acid (NPC236709)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	RECQL,LMNA,CES1,F2
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RELA,F2,RORC
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RELA,RORC
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	RORC,RELA
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	RELA,F2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	RECQL,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	RECQL,LMNA
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	RORC,F2
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	RELA
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	RELA
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	NCT02337933
Diabetic polyneuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C03.0	NCT04649203
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT04403568
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	RORC
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	RORC
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	RORC
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	F2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Styrax Japonicus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

27 All known Ingredients in Total

10 Ingredients with Acceptable Bioavailablity

15 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Multiple sclerosis

Psoriasis

Solid tumour/cancer

Type 2 diabetes mellitus

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Tetralogy of Fallot

Acute myeloid leukaemia

Choreiform disorder

Cerebral ischaemic stroke

Cardiovascular disease

Chronic arterial occlusive disease

Bleeding disorder

Synthesis disorder

Coronary thrombosis

Thrombosis

Skin and skin-structure infection

Rheumatoid arthritis

Irritable bowel syndrome

Atopic eczema

Lupus erythematosus

Coagulation defect

Fungal infection

Acute/subacute hepatic failure

Angina pectoris

Myocardial infarction

Ischaemic/haemorrhagic stroke

Muscular dystrophy

Nutritional deficiency

Peroxisomal disease

Hyper-lipoproteinaemia

Crohn disease

Asthma

Thrombocytopenia

Indeterminate colitis

Lung cancer

Autoimmune disease

Diabetes mellitus, type unspecified

Metabolic disorder

Diabetic polyneuropathy

Prostate cancer

Primary sclerosing cholangitis

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of kidney, except renal pelvis

Superficial ovarian endometriosis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Glioblastoma of brain

Germ cell tumour of testis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities