• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Zanthoxylum Planispinum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCAAAACCTCTGCAAGAGCAGAACGACCCGTGAACTTGTGATAACAATCGTGGGGAGTTGTGGCTTCGCGGCCGCACCCCCATGTCTCTGCGGGTGCGGGACTAGTCCCGTTCCCCGCGGGGGCGAACAACGAACCCCCGGCGCGGTCTGCGCCAAGGAAATGTAACGAGAGAGCACGCTCTCGGGGCCCCGGACACGGTGTGCTCTGGGACGCGGCGCCTTCTTTCACTCTATCTATAACGACTCTCGGCAACGGATACCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCACCCCTCCGGGGGCCTGGCGGTGCGGGCGGATAATGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCCAAAATCTGAGTCCCCGGCGACCGGAGCCGCGACGTTCGGTGGTGAAAACAAACCTCTCGAGCTCACGTCTCGTGCCCGGCCCCCTGTTACGGGACTCATGGACCCTGAAGCTCTGCGCAAGCAGCGCTCGCA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCCACCCCACCCCTCCGGGGGCCTGGCGGTGCGGGCGGATAATGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCCAAAATCTGAGTCCCCGGCGACCGGAGCCGCGACGTTCGGTGGTGAAAACAAACCTCTCGAGCTCACGTCTCGTGCCCGGCCCCCTGTTACGGGACTCATGGACCCTGAAGCTCTGCGCAAGCAGCGCTCGCA
Taxonomic Information

Plant ID: NPO17862
Plant Latin Name: Zanthoxylum Planispinum
Taxonomy Genus: Zanthoxylum
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 1196222
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

27 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC73199

Ingredient ID: NPC70872

Ingredient ID: NPC57739

Ingredient ID: NPC49536

Ingredient ID: NPC42403

Ingredient ID: NPC4025

Ingredient ID: NPC37733

Ingredient ID: NPC35883

Ingredient ID: NPC34973

Ingredient ID: NPC34770

Ingredient ID: NPC296663

Ingredient ID: NPC276861

Ingredient ID: NPC269367

Ingredient ID: NPC268574

Ingredient ID: NPC235076

Ingredient ID: NPC232206

Ingredient ID: NPC197467

Ingredient ID: NPC179694

Ingredient ID: NPC154351

Ingredient ID: NPC146792

Ingredient ID: NPC146319

Ingredient ID: NPC144205

Ingredient ID: NPC141080

Ingredient ID: NPC138925

Ingredient ID: NPC131885

Ingredient ID: NPC118121

Ingredient ID: NPC105137