• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lycium Chinense


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTTCAACACTGGGGAGCCGCGCGGGCTGGGTGCTTCGGCCCCCCCGTGCGCGCGTCTCCCCCTCGTCCCCGGCGCGCGCGCCCGCGCGCGCGTCGGGCGACTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTTAAATTGATAGCCTGCCTCTCGCGCCCCGTCCGCGGTGCGCGCGGGAGGACCTGTGCTTCTCTTGAAACAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCGCACACCGCGCCCATGCTCTGGGTTGCGGTGGTGTCGCGGGGCGGATACTGGCCTCCCGTGCGCCTCGCGCTCGCGGCTGGCCTAAATGAGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCTCGAAGTGTCGTGGCTATGCCCCGTCGCGCGTTTGGCCTCCCAGACCCTTCTTGCGCTTAGGCGCTCCGA

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTTCAACACTGGGGAGCCGCGCGGGCTGGGTGCTTCGGCCCCCCCGTGCGCGCGTCTCCCCCTCGTCCCCGGCGCGCGCGCCCGCGCGCGCGTCGGGCGACTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTTAAATTGATAGCCTGCCTCTCGCGCCCCGTCCGCGGTGCGCGCGGGAGGACCTGTGCTTCTCTTGAAACAAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCGCGCACCGCGCCCATACTCTGGGTTGCGGTGGTGTCGCGGGGCGGATACTGGCCTCCCGTGCGCCTCGCGCTCGCGGCCGGCCTAAATGAAAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCTCGAAGTGTCGTGGCTATGCCCCGTCGCGCGTTTGGCCTCCCGGACCCTTCTTGCGCTTAGGCGCTCCGACC
Taxonomic Information

Plant ID: NPO17823
Plant Latin Name: Lycium Chinense
Taxonomy Genus: Lycium
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 112883
Plant-of-the-World-Online: 816389-1

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Antibacterial; Antipyretic; Cancer; Haemostatic; Hepatic; Hypoglycaemic; Infertility; Kidney; Ophthalmic; Tonic; Vasodilator

Geographical Distribution

Turkey; Italy; Nepal; France; Ireland; Laos; Russia; China; Germany; Spain; Netherlands; United States; Sweden; Vietnam; Hungary; Switzerland; South Korea; Pakistan; Romania; Portugal; South Africa; United Kingdom; Greece; Japan; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

307 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


202 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

155 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98307

Ingredient ID: NPC96294

Ingredient ID: NPC95952

Ingredient ID: NPC95539

Ingredient ID: NPC94167

Ingredient ID: NPC93081

Ingredient ID: NPC93077

Ingredient ID: NPC92592

Ingredient ID: NPC91081

Ingredient ID: NPC89390

Ingredient ID: NPC88481

Ingredient ID: NPC87564

Ingredient ID: NPC85813

Ingredient ID: NPC8505

Ingredient ID: NPC84809

Ingredient ID: NPC84281

Ingredient ID: NPC836

Ingredient ID: NPC82648

Ingredient ID: NPC82460

Ingredient ID: NPC81010

Ingredient ID: NPC79321

Ingredient ID: NPC78500

Ingredient ID: NPC77448

Ingredient ID: NPC77446

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC71191

Ingredient ID: NPC70744

Ingredient ID: NPC6984

Ingredient ID: NPC68873

Ingredient ID: NPC68271

Ingredient ID: NPC66681

Ingredient ID: NPC66303

Ingredient ID: NPC65089

Ingredient ID: NPC64370

Ingredient ID: NPC64022

Ingredient ID: NPC60942

Ingredient ID: NPC59817

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC56505

Ingredient ID: NPC55484

Ingredient ID: NPC5462

Ingredient ID: NPC5326

Ingredient ID: NPC52955

Ingredient ID: NPC52711

Ingredient ID: NPC52403

Ingredient ID: NPC52029

Ingredient ID: NPC50898

Ingredient ID: NPC50380

Ingredient ID: NPC49894

Ingredient ID: NPC49151

Ingredient ID: NPC48747

Ingredient ID: NPC478510

Ingredient ID: NPC478509

Ingredient ID: NPC478508

Ingredient ID: NPC478507

Ingredient ID: NPC478506

Ingredient ID: NPC478505

Ingredient ID: NPC478504

Ingredient ID: NPC473950

Ingredient ID: NPC47268

Ingredient ID: NPC47168

Ingredient ID: NPC471032

Ingredient ID: NPC471031

Ingredient ID: NPC470935

Ingredient ID: NPC470080

Ingredient ID: NPC46801

Ingredient ID: NPC46780

Ingredient ID: NPC46359

Ingredient ID: NPC46248

Ingredient ID: NPC45782

Ingredient ID: NPC45614

Ingredient ID: NPC42577

Ingredient ID: NPC42471

Ingredient ID: NPC42052

Ingredient ID: NPC41473

Ingredient ID: NPC40918

Ingredient ID: NPC3857

Ingredient ID: NPC38069

Ingredient ID: NPC35923

Ingredient ID: NPC35565

Ingredient ID: NPC34764

Ingredient ID: NPC34589

Ingredient ID: NPC32977

Ingredient ID: NPC328788

Ingredient ID: NPC327662

Ingredient ID: NPC327488

Ingredient ID: NPC327317

Ingredient ID: NPC327013

Ingredient ID: NPC326948

Ingredient ID: NPC326415

Ingredient ID: NPC323434

Ingredient ID: NPC32279

Ingredient ID: NPC322171

Ingredient ID: NPC321251

Ingredient ID: NPC318588

Ingredient ID: NPC318300

Ingredient ID: NPC316926

Ingredient ID: NPC315603

Ingredient ID: NPC313851

Ingredient ID: NPC313179

Ingredient ID: NPC313059

Ingredient ID: NPC312770

Ingredient ID: NPC307732

Ingredient ID: NPC30489

Ingredient ID: NPC30433

Ingredient ID: NPC302857

Ingredient ID: NPC302327

Ingredient ID: NPC301585

Ingredient ID: NPC300059

Ingredient ID: NPC299515

Ingredient ID: NPC295777

Ingredient ID: NPC294902

Ingredient ID: NPC294815

Ingredient ID: NPC294548

Ingredient ID: NPC291886

Ingredient ID: NPC291787

Ingredient ID: NPC291517

Ingredient ID: NPC291066

Ingredient ID: NPC291027

Ingredient ID: NPC290613

Ingredient ID: NPC290598

Ingredient ID: NPC290442

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC289974

Ingredient ID: NPC289758

Ingredient ID: NPC28815

Ingredient ID: NPC286233

Ingredient ID: NPC285343

Ingredient ID: NPC28446

Ingredient ID: NPC283923

Ingredient ID: NPC283790

Ingredient ID: NPC283148

Ingredient ID: NPC282909

Ingredient ID: NPC28227

Ingredient ID: NPC282102

Ingredient ID: NPC281629

Ingredient ID: NPC281457

Ingredient ID: NPC280717

Ingredient ID: NPC280135

Ingredient ID: NPC279895

Ingredient ID: NPC279300

Ingredient ID: NPC278683

Ingredient ID: NPC2785

Ingredient ID: NPC278430

Ingredient ID: NPC278310

Ingredient ID: NPC275462

Ingredient ID: NPC275175

Ingredient ID: NPC273390

Ingredient ID: NPC273385

Ingredient ID: NPC271808

Ingredient ID: NPC270637

Ingredient ID: NPC270334

Ingredient ID: NPC269648

Ingredient ID: NPC268572

Ingredient ID: NPC268221

Ingredient ID: NPC266636

Ingredient ID: NPC266539

Ingredient ID: NPC265885

Ingredient ID: NPC265800

Ingredient ID: NPC265645

Ingredient ID: NPC262775

Ingredient ID: NPC258130

Ingredient ID: NPC256186

Ingredient ID: NPC255452

Ingredient ID: NPC254509

Ingredient ID: NPC251788

Ingredient ID: NPC251611

Ingredient ID: NPC25159

Ingredient ID: NPC251387

Ingredient ID: NPC250539

Ingredient ID: NPC249801

Ingredient ID: NPC24967

Ingredient ID: NPC249045

Ingredient ID: NPC244879

Ingredient ID: NPC243728

Ingredient ID: NPC243550

Ingredient ID: NPC242503

Ingredient ID: NPC24230

Ingredient ID: NPC242203

Ingredient ID: NPC24101

Ingredient ID: NPC239564

Ingredient ID: NPC239530

Ingredient ID: NPC236119

Ingredient ID: NPC235901

Ingredient ID: NPC234005

Ingredient ID: NPC233231

Ingredient ID: NPC232189

Ingredient ID: NPC232001

Ingredient ID: NPC231772

Ingredient ID: NPC230301

Ingredient ID: NPC226087

Ingredient ID: NPC223697

Ingredient ID: NPC222997

Ingredient ID: NPC222084

Ingredient ID: NPC218041

Ingredient ID: NPC217226

Ingredient ID: NPC217218

Ingredient ID: NPC216630

Ingredient ID: NPC216330

Ingredient ID: NPC216083

Ingredient ID: NPC215241

Ingredient ID: NPC211913

Ingredient ID: NPC211401

Ingredient ID: NPC209970

Ingredient ID: NPC209773

Ingredient ID: NPC209111

Ingredient ID: NPC209054

Ingredient ID: NPC206800

Ingredient ID: NPC206500

Ingredient ID: NPC203064

Ingredient ID: NPC200544

Ingredient ID: NPC197977

Ingredient ID: NPC196776

Ingredient ID: NPC195749

Ingredient ID: NPC195064

Ingredient ID: NPC194944

Ingredient ID: NPC193154

Ingredient ID: NPC190810

Ingredient ID: NPC187770

Ingredient ID: NPC187738

Ingredient ID: NPC18722

Ingredient ID: NPC185839

Ingredient ID: NPC184571

Ingredient ID: NPC18188

Ingredient ID: NPC181465

Ingredient ID: NPC1813

Ingredient ID: NPC181153

Ingredient ID: NPC179831

Ingredient ID: NPC179480

Ingredient ID: NPC179250

Ingredient ID: NPC17892

Ingredient ID: NPC1788

Ingredient ID: NPC17810

Ingredient ID: NPC176869

Ingredient ID: NPC176740

Ingredient ID: NPC173582

Ingredient ID: NPC171148

Ingredient ID: NPC170538

Ingredient ID: NPC169786

Ingredient ID: NPC169485

Ingredient ID: NPC168879

Ingredient ID: NPC167976

Ingredient ID: NPC167545

Ingredient ID: NPC167400

Ingredient ID: NPC164487

Ingredient ID: NPC163556

Ingredient ID: NPC163191

Ingredient ID: NPC161555

Ingredient ID: NPC160900

Ingredient ID: NPC16087

Ingredient ID: NPC160176

Ingredient ID: NPC158876

Ingredient ID: NPC158565

Ingredient ID: NPC154515

Ingredient ID: NPC154016

Ingredient ID: NPC153958

Ingredient ID: NPC153552

Ingredient ID: NPC151874

Ingredient ID: NPC151633

Ingredient ID: NPC151157

Ingredient ID: NPC149184

Ingredient ID: NPC148951

Ingredient ID: NPC148835

Ingredient ID: NPC14600

Ingredient ID: NPC14330

Ingredient ID: NPC142963

Ingredient ID: NPC142597

Ingredient ID: NPC142319

Ingredient ID: NPC140872

Ingredient ID: NPC140389

Ingredient ID: NPC139548

Ingredient ID: NPC139416

Ingredient ID: NPC137949

Ingredient ID: NPC137755

Ingredient ID: NPC137167

Ingredient ID: NPC136996

Ingredient ID: NPC134616

Ingredient ID: NPC131969

Ingredient ID: NPC127402

Ingredient ID: NPC126681

Ingredient ID: NPC125144

Ingredient ID: NPC125039

Ingredient ID: NPC124673

Ingredient ID: NPC12455

Ingredient ID: NPC122962

Ingredient ID: NPC122009

Ingredient ID: NPC121346

Ingredient ID: NPC120635

Ingredient ID: NPC120454

Ingredient ID: NPC115723

Ingredient ID: NPC113837

Ingredient ID: NPC113835

Ingredient ID: NPC111888

Ingredient ID: NPC111617

Ingredient ID: NPC111182

Ingredient ID: NPC110297

Ingredient ID: NPC108581

Ingredient ID: NPC107602

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC103612

Ingredient ID: NPC103347

Ingredient ID: NPC102449

Ingredient ID: NPC100276