CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Trigonostemon Reidioides

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CGACCAGCGAACATGTTATTCTACATAGGGTGCTCGGAGGGGCTTCGGCCTTTTCGCTGCCCTCGAGTGCTGGGTGGAGCTATTCAAGGAGTTGCTCTGTGCACTCCCAGTTGTGCTCTTCCTAGCCGAACAACCAACCCCGGCGCCGGACGCGCCAAGGAAAAATGAAATGAAAAGAGCGTGCTCCTAATGGCCCCAGAAATGGACCAAACCATAGGATGCGTCGTACTCTTTCGAGAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACAACTGTTGCTCCAACCCCCTTTGCCTTCAGCAAGGGATGCGGGGCGGATTCTGGCCTCCCGCGAGCTCATTGCTTCCGGTTGGCCTAAAATCTGATTCCTCGGCTATGAGCGCCACGACAATCGGTGGTTGCTAGACCTTCGGACAAAGTCGTTTGCATCCTCAGCTTTGGAACTCACAGACCCATTGCGTGCCAAAGTGCACGCTCCTA

Click for details-----ITS1

Click for details-----ITS2

AACTGTTGCTCCAACCCCCTTTGCCTTCAGCAAGGGATGCGGGGCGGATTCTGGCCTCCCGCGAGCTCATTGCTTCCGGTTGGCCTAAAATCTGATTCCTCGGCTATGAGCGCCACGACAATCGGTGGTTGCTAGACCTTCGGACAAAGTCGTTTGCATCCTCAGCTTTGGAACTCACAGACCCATTGCGTGCCAAAGTGCACGCTCCTA

Taxonomic Information

Plant ID: NPO17790
Plant Latin Name: Trigonostemon Reidioides
Taxonomy Genus: Trigonostemon
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: 358060-1

Used in Medicines

Country/Region:

Thailand

Traditional Medicine System:

Geographical Distribution

Thailand; Vietnam; Myanmar; Cambodia; Laos

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

78 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

52 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC9609

Ingredient ID: NPC95460

Ingredient ID: NPC89944

Ingredient ID: NPC8463

Ingredient ID: NPC66868

Ingredient ID: NPC62792

Ingredient ID: NPC59650

Ingredient ID: NPC58716

Ingredient ID: NPC54172

Ingredient ID: NPC52005

Ingredient ID: NPC478125

Ingredient ID: NPC478124

Ingredient ID: NPC478123

Ingredient ID: NPC45367

Ingredient ID: NPC44931

Ingredient ID: NPC42149

Ingredient ID: NPC41979

Ingredient ID: NPC38884

Ingredient ID: NPC324364

Ingredient ID: NPC322204

Ingredient ID: NPC321756

Ingredient ID: NPC320209

Ingredient ID: NPC318890

Ingredient ID: NPC308289

Ingredient ID: NPC302426

Ingredient ID: NPC299089

Ingredient ID: NPC298072

Ingredient ID: NPC293588

Ingredient ID: NPC287387

Ingredient ID: NPC282116

Ingredient ID: NPC279525

Ingredient ID: NPC274499

Ingredient ID: NPC26937

Ingredient ID: NPC268760

Ingredient ID: NPC263251

Ingredient ID: NPC261947

Ingredient ID: NPC258104

Ingredient ID: NPC255580

Ingredient ID: NPC255497

Ingredient ID: NPC249616

Ingredient ID: NPC241579

Ingredient ID: NPC224242

Ingredient ID: NPC220518

Ingredient ID: NPC21534

Ingredient ID: NPC212591

Ingredient ID: NPC210003

Ingredient ID: NPC20836

Ingredient ID: NPC20505

Ingredient ID: NPC204443

Ingredient ID: NPC204204

Ingredient ID: NPC203891

Ingredient ID: NPC203670

Ingredient ID: NPC196209

Ingredient ID: NPC192978

Ingredient ID: NPC189142

Ingredient ID: NPC187206

Ingredient ID: NPC183401

Ingredient ID: NPC182277

Ingredient ID: NPC181465

Ingredient ID: NPC176740

Ingredient ID: NPC176728

Ingredient ID: NPC176300

Ingredient ID: NPC169232

Ingredient ID: NPC165287

Ingredient ID: NPC16209

Ingredient ID: NPC160951

Ingredient ID: NPC156222

Ingredient ID: NPC153701

Ingredient ID: NPC136920

Ingredient ID: NPC136014

Ingredient ID: NPC12529

Ingredient ID: NPC123928

Ingredient ID: NPC115275

Ingredient ID: NPC11433

Ingredient ID: NPC110070

Ingredient ID: NPC109594

Ingredient ID: NPC109024

Ingredient ID: NPC101692

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Peptide receptor (family A GPCR)	CCR6	C-C chemokine receptor type 6	P51684	CHEMBL4423
Therapeutic Target	Peptide receptor (family A GPCR)	TSHR	Thyroid stimulating hormone receptor	P16473	CHEMBL1963
Therapeutic Target	Peptide receptor (family B GPCR)	GCGR	Glucagon receptor	P47871	CHEMBL1985
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA1B	Alpha-1b adrenergic receptor	P35368	CHEMBL232
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA1A	Alpha-1a adrenergic receptor	P35348	CHEMBL229
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	AURKA,CCR6,AURKB,TSHR,ACHE,KDR,ADRA1B,LMNA
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	AURKA,CYP1B1,AURKB,ACHE,ADRA1B,KIT,LMNA
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	AURKB,CYP19A1,ACHE,CCR6,AURKB,TSHR
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AURKA,AURKB,CYP19A1,AURKA,AURKB,CYP19A1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	GCGR,CCR6,CYP19A1,AURKB,TSHR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AURKA,CCR6,CYP19A1,AURKB,KIT
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	AURKA,CCR6,AURKB,KDR,LMNA
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	GCGR,AURKA,AURKB,TSHR,ACHE
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CYP1B1,CYP19A1,TSHR,KDR,LMNA
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	AURKA,CCR6,AURKB,CYP19A1,KIT
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	KDR,AURKB,GCGR,AURKA
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB,AURKA,ADRA1A NCT01705652
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	AURKA,KIT,KDR,AURKB
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	GCGR,AURKA,CCR6,TSHR
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	GCGR,CCR6,ACHE,KIT
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	GCGR,AURKA,AURKB,TSHR
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	GCGR,CYP1A1,ACHE,ADRA1B
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	GCGR,CYP1A1,AURKA,AURKB
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,AURKA,AURKB,KIT
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	GCGR,ACHE,KDR,KIT
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AURKB,AURKA,KIT
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	AURKA,KIT,KDR
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	AURKA,KIT,KDR
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CYP19A1,AURKA,KDR
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE,KIT,KDR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,ADRA1B,ADRA1A
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	AURKA,AURKB,LMNA
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	AURKA,AURKB,CYP19A1
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AURKA,AURKB,ADRA1B
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	CCR6,ADRA1B,KIT
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	AURKA,AURKB,ACHE
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	GCGR,ADRA1B,CYP1B1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,ADRA1A,CYP19A1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CCR6,CYP1B1,ACHE
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	GCGR,AURKA,AURKB
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDR,KIT
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	ADRA1A,ADRA1B
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KDR,KIT
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	GCGR,ADRA1B
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	KIT,KDR
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	KDR,TSHR
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,KIT
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	KDR,KIT
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	AURKA,AURKB
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	KDR,KIT
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	KIT,KDR
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ADRA1A,ACHE
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1,TSHR
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE,CYP19A1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AURKA,AURKB
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,ACHE
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AURKA,AURKB
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1,ACHE
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,ADRA1B
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	KDR
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	KIT
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	KDR
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ADRA1A
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KDR
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	KIT
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	KIT
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	KIT
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	KIT
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	GCGR
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	KDR
Mental/behavioural/neurodevelopmental disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6E20-6E8Z	ADRA1B
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	GCGR
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR
Hypo-glycaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A41	GCGR
Malignant intestine neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C0Z	KIT
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	KDR
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	ADRA1B
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	KIT
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	KDR
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	KDR
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	KDR
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KIT
Pancreatic internal secretion disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A4Y	GCGR
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Hypo-thyroidism Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A00	TSHR
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	KDR
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	KDR
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	TSHR
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	AURKB
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	TSHR
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	ADRA1B
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	KIT
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Trigonostemon Reidioides

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

78 All known Ingredients in Total

52 Ingredients with Acceptable Bioavailablity

29 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Other specified malignant neoplasms of kidney, except renal pelvis

Hepatocellular carcinoma of liver

Carcinosarcoma of uterus

Hepatoblastoma

Mesothelioma of pleura

Adenocarcinoma of bronchus or lung

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Acute diabete complication

Prostate cancer

Solid tumour/cancer

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Squamous cell carcinoma of bronchus or lung

Cytomegaloviral disease

Malignant neoplasms of corpus uteri, unspecified

Renal cell carcinoma, chromophobe type

Germ cell tumour of testis

Acute myeloid leukaemia

Lung cancer

Liver cancer

Breast cancer

Alzheimer disease

Pain, unspecified

Malignant neoplasms of biliary tract, distal bile duct

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Melanoma of skin

Malignant neoplasms of oesophagus

Malignant neoplasms of thyroid gland, unspecified

Chikungunya virus disease

Malignant neoplasms of thymus

Invasive carcinoma of breast

Myelodysplastic syndrome

Pulmonary hypertension

Renal cell carcinoma

Obesity

Brain cancer

Thyroid cancer

Gastrointestinal stromal tumour

Thrombocytopenia

Malignant haematopoietic neoplasm

Colorectal cancer

Multiple myeloma

Mild neurocognitive disorder

Coeliac disease

West Nile virus infection

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Systemic lupus erythematosus

Carpal tunnel syndrome

Digestive organ benign neoplasm

Peritoneal cancer

Inflammatory arthropathy

Cushing syndrome

Glaucoma

Head and neck cancer

Prostate hyperplasia

Melanoma