• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Inula Britannica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGTAGGTGACCTGCGGAAGGATCATTGTCGAAGCCTATAAGCGAACGACCCGTGAACGTGTAACAACATCAGGGCATCATAGGTCTCGGGCTTTTGCTCGTGACGTATGGCGCCTCGTCGATTTGCATCCATGGTCGCCTCTTCGGAGCCTCCATGATGTCAAAAAAGGCGTTAACCAACCCCGGCACGGAATGTGCCAAGGAAAAATAAACTTTAAGACGGCCTCGTTCATGTCGCCCCGTTCGCGGTGTGTGCATGTGACGCGGCTTCTTTGTAAACCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCTCACCTTGCATCCCCAAAGGGGTGTGTGAGATAGGAGCGGATACTGGTCTCCCGTGCCTATGGTGTGGTTGGCCAAAATAGGAGTCTCCTTTGACGGACACACGGCAAGTGGTGGTTGACAAAACCTTAGTCTCGTGCTGTGTGTCCTGACTTGTAAGCGATGACCTCGTAAACGACCCTAACGTGTCGTCTTATGACGACGCTTCGA

Click for details-----ITS1

CGTAGGTGACCTGCGGAAGGATCATTGTCGAAGCCTATAAGCGAACGACCCGTGAACGTGTAACAACATCAGGGCATCATAGGTCTCGGGCTTTTGCTCGTGACGTATGGCGCCTCGTCGATTTGCATCCATGGTCGCCTCTTCGGAGCCTCCATGATGTCAAAAAAGGCGTTAACCAACCCCGGCACGGAATGTGCCAAGGAAAAATAAACTTTAAGACGGCCTCGTTCATGTCGCCCCGTTCGCGGTGTGTGCATGTGACGCGGCTTCTTTGTAAACCATAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO17782
Plant Latin Name: Inula Britannica
Taxonomy Genus: Inula
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 119176
Plant-of-the-World-Online: 225778-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Antiemetic; Cancer; Carminative; Cholagogue; Deobstruent; Depurative; Diuretic; Expectorant; Laxative; Resolvent; Stomachic; Tonic; Vulnerary

Geographical Distribution

Canada; Turkey; Italy; Turkmenistan; Nepal; Mongolia; France; Netherlands; Ireland; Norway; Uzbekistan; Belarus; Iran; China; Belgium; Germany; Iraq; Kazakhstan; Spain; Ukraine; Georgia; Denmark; Poland; Finland; Sweden; Japan; Switzerland; Russia; Bulgaria; Romania; Albania; Portugal; South Africa; India; United Kingdom; Austria; Greece; Hungary; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

94 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


59 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

48 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9851

Ingredient ID: NPC93376

Ingredient ID: NPC92399

Ingredient ID: NPC84868

Ingredient ID: NPC84425

Ingredient ID: NPC81010

Ingredient ID: NPC80427

Ingredient ID: NPC76336

Ingredient ID: NPC71536

Ingredient ID: NPC64343

Ingredient ID: NPC61506

Ingredient ID: NPC49341

Ingredient ID: NPC477302

Ingredient ID: NPC37331

Ingredient ID: NPC36835

Ingredient ID: NPC32977

Ingredient ID: NPC327341

Ingredient ID: NPC324696

Ingredient ID: NPC320602

Ingredient ID: NPC319108

Ingredient ID: NPC318478

Ingredient ID: NPC318138

Ingredient ID: NPC317409

Ingredient ID: NPC317017

Ingredient ID: NPC303090

Ingredient ID: NPC302857

Ingredient ID: NPC298084

Ingredient ID: NPC297514

Ingredient ID: NPC295799

Ingredient ID: NPC294902

Ingredient ID: NPC290791

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC284948

Ingredient ID: NPC279777

Ingredient ID: NPC279121

Ingredient ID: NPC270465

Ingredient ID: NPC268724

Ingredient ID: NPC264910

Ingredient ID: NPC260491

Ingredient ID: NPC256032

Ingredient ID: NPC25475

Ingredient ID: NPC246162

Ingredient ID: NPC245014

Ingredient ID: NPC243702

Ingredient ID: NPC242906

Ingredient ID: NPC240476

Ingredient ID: NPC233994

Ingredient ID: NPC233443

Ingredient ID: NPC23188

Ingredient ID: NPC230301

Ingredient ID: NPC223549

Ingredient ID: NPC218927

Ingredient ID: NPC216385

Ingredient ID: NPC211532

Ingredient ID: NPC211009

Ingredient ID: NPC20791

Ingredient ID: NPC206001

Ingredient ID: NPC200112

Ingredient ID: NPC197396

Ingredient ID: NPC194654

Ingredient ID: NPC192638

Ingredient ID: NPC191839

Ingredient ID: NPC191254

Ingredient ID: NPC189142

Ingredient ID: NPC181437

Ingredient ID: NPC177118

Ingredient ID: NPC176740

Ingredient ID: NPC174937

Ingredient ID: NPC171204

Ingredient ID: NPC169412

Ingredient ID: NPC167976

Ingredient ID: NPC167881

Ingredient ID: NPC163524

Ingredient ID: NPC159635

Ingredient ID: NPC157288

Ingredient ID: NPC156353

Ingredient ID: NPC145139

Ingredient ID: NPC138408

Ingredient ID: NPC136879

Ingredient ID: NPC135391

Ingredient ID: NPC133671

Ingredient ID: NPC125062

Ingredient ID: NPC122318

Ingredient ID: NPC118534

Ingredient ID: NPC116775

Ingredient ID: NPC116603

Ingredient ID: NPC115557

Ingredient ID: NPC113733

Ingredient ID: NPC110899

Ingredient ID: NPC109647

Ingredient ID: NPC1075

Ingredient ID: NPC100887

Ingredient ID: NPC100551