• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hemerocallis Fulva


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAGGCCCCGAAACGGACCACACCGCGAACCACAGAGCTGACCCTCACCATCGTCACGCTGCCTGCCTGCCCCGCCCCGTCTGCGCGGCCCCTCTGGGCGGTGCCTCCGGGGCGCAACGGCAGCGGCGGGACGAGAACACCCCCCCGGCGCAATCGGGCGCCAAGGAACACAAACCGTGCCGCCGCGGCGAACGGGGCCTCCGGTCCCGGACGCCGCGACGCTTCTGAAAGAAAAATGTACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCTCCAAGCCCCCCCTCCCGCGAAGAGCGGCGGGGGGCGCGGACGCGGAGATTGCCCCCCCGTGCCTGCCCGGCGCGGCGGGGCGAAGTTCGTGCCGTCGGCCCGGCCGAGCGCGGCGAGTGGTGGACATCATGCGCCGTCGACTCGGACCGCGGCCGGAAGCGCGCCGGGACCCAGCCCGTTCCCCCCGAGCCACCCATCGGCGGAGGGGGATCGGAAACGCGACCCCAGGTCAGG

Click for details-----ITS1

TCGAAGGCCCCGAAACGGACCACACCGCGAACCACAGAGCTGACCCTCACCATCGTCACGCCGCCTGCCYGCCCCGCCCCGTCTGCGCGGCCCCTCTGGGCGGCGCCTCCGGGGCGCAACGGCAGCGGCGGGACGAGAACACCCCCCCGGCGCAATCGGGCGCCAAGGAACACAAACCGTGCCGCCGCGGCGAACGGGGCCTCCGGTCCCGGACGCCGCGACGCTTCTGAAAGAAAAATGTA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO17774
Plant Latin Name: Hemerocallis Fulva
Taxonomy Genus: Hemerocallis
Taxonomy Family: Xanthorrhoeaceae

Plant External Links:

NCBI TaxonomyDB: 34190
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Anodyne; Anthelmintic; Antidote; Antiemetic; Antispasmodic; Blood purifier; Cancer; Depurative; Diuretic; Febrifuge; Laxative; Sedative

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

50 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC89635

Ingredient ID: NPC88898

Ingredient ID: NPC86372

Ingredient ID: NPC85948

Ingredient ID: NPC74259

Ingredient ID: NPC72260

Ingredient ID: NPC70622

Ingredient ID: NPC60056

Ingredient ID: NPC59790

Ingredient ID: NPC5785

Ingredient ID: NPC56161

Ingredient ID: NPC54962

Ingredient ID: NPC41586

Ingredient ID: NPC3224

Ingredient ID: NPC308492

Ingredient ID: NPC307759

Ingredient ID: NPC307699

Ingredient ID: NPC302857

Ingredient ID: NPC302783

Ingredient ID: NPC295295

Ingredient ID: NPC294902

Ingredient ID: NPC288816

Ingredient ID: NPC288089

Ingredient ID: NPC283544

Ingredient ID: NPC282923

Ingredient ID: NPC250436

Ingredient ID: NPC249912

Ingredient ID: NPC243062

Ingredient ID: NPC237067

Ingredient ID: NPC231518

Ingredient ID: NPC222497

Ingredient ID: NPC219876

Ingredient ID: NPC213773

Ingredient ID: NPC208193

Ingredient ID: NPC204694

Ingredient ID: NPC202847

Ingredient ID: NPC193893

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC173555

Ingredient ID: NPC162656

Ingredient ID: NPC147543

Ingredient ID: NPC146787

Ingredient ID: NPC143211

Ingredient ID: NPC14005

Ingredient ID: NPC138125

Ingredient ID: NPC126029

Ingredient ID: NPC124478

Ingredient ID: NPC117445

Ingredient ID: NPC10689