• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Inula Helenium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAGCCTATAAAGCAGAACGACCCGTGAACGTGTAACAACATCGGAGCGTCATAGTGATCCGGCTTTTGTTGGTGACCTATGGCGCCTCGTCGATTTGCATCCATGGTCGCCTCTTCGGAGCCTCCTTGATGTCAAAAAGGCGTAACAACAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACTTTAAGACGGCCTAGTGTCATGTTGCCCCGTTCGCGGTGTGTGCATGGGACGTGGCTTCTTTGTAAACCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCACTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTGTCGCTCCTCTCCATGCCTCCTCAAAGGGGTGTGCGAGATAGGAGCGGATACTGGTCTCCCGTGCCTACGGTGCGGTTGGCCAAAATAGGAGTCTCCTTTGATGGACACACGGCAAGTGGTGGTTGACAAAACCTTTAGTCTCGTGTCGTGTGTCCTGACTTGTAAGCGAAGACCTCGTAAACTACCCTATGGTGTCGTCTTATGACGACGCTTCGA

Click for details-----ITS1

GTCGAAGCCTATAAAGCAGAACGACCCGTGAACGTGTAACAACATCGGAGCGTCATAGTGATCCGGCTTTTGTTGGTGACCTATGGCGCCTCGTCGATTTGCATCCATGGTCGCCTCTTCGGAGCCTCCTTGATGTCAAAAAGGCGTAACAACAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACTTTAAGACGGCCTAGTGTCATGTTGCCCCGTTCGCGGTGTGTGCATGGGACGTGGCTTCTTTGTAAACCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO17755
Plant Latin Name: Inula Helenium
Taxonomy Genus: Inula
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 55635
Plant-of-the-World-Online: 225914-1

Used in Medicines

Country/Region:
Albania; Italy; Lithuania; Finland; India; China; Iraq; Bulgaria

Traditional Medicine System:
Unani; TCM; Homeopathy; Ayurveda

Geographical Distribution

Canada; Turkey; Italy; Turkmenistan; Lithuania; Mongolia; France; Netherlands; Ireland; Norway; Uzbekistan; Belarus; Iran; Iceland; China; Germany; Iraq; Kazakhstan; Poland; Spain; Ukraine; Georgia; Denmark; Philippines; Indonesia; United States; Sweden; Finland; New Zealand; Russia; Bulgaria; Romania; Albania; Portugal; South Africa; India; United Kingdom; Austria; Greece; Hungary; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

195 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


158 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

77 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9880

Ingredient ID: NPC95192

Ingredient ID: NPC92489

Ingredient ID: NPC91923

Ingredient ID: NPC90374

Ingredient ID: NPC90014

Ingredient ID: NPC88701

Ingredient ID: NPC88566

Ingredient ID: NPC85813

Ingredient ID: NPC85665

Ingredient ID: NPC83805

Ingredient ID: NPC82460

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC7491

Ingredient ID: NPC72307

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC71092

Ingredient ID: NPC69750

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC67591

Ingredient ID: NPC66681

Ingredient ID: NPC64758

Ingredient ID: NPC63760

Ingredient ID: NPC61757

Ingredient ID: NPC59581

Ingredient ID: NPC59570

Ingredient ID: NPC58956

Ingredient ID: NPC58522

Ingredient ID: NPC57234

Ingredient ID: NPC56369

Ingredient ID: NPC55908

Ingredient ID: NPC55740

Ingredient ID: NPC54264

Ingredient ID: NPC53720

Ingredient ID: NPC52897

Ingredient ID: NPC49389

Ingredient ID: NPC48764

Ingredient ID: NPC45270

Ingredient ID: NPC45107

Ingredient ID: NPC44751

Ingredient ID: NPC44671

Ingredient ID: NPC43792

Ingredient ID: NPC43565

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC41348

Ingredient ID: NPC40287

Ingredient ID: NPC40249

Ingredient ID: NPC36408

Ingredient ID: NPC35574

Ingredient ID: NPC35019

Ingredient ID: NPC34764

Ingredient ID: NPC31891

Ingredient ID: NPC31509

Ingredient ID: NPC313107

Ingredient ID: NPC310478

Ingredient ID: NPC304108

Ingredient ID: NPC302857

Ingredient ID: NPC296753

Ingredient ID: NPC295777

Ingredient ID: NPC295633

Ingredient ID: NPC294902

Ingredient ID: NPC294136

Ingredient ID: NPC292869

Ingredient ID: NPC289632

Ingredient ID: NPC289388

Ingredient ID: NPC288826

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC287191

Ingredient ID: NPC283212

Ingredient ID: NPC278687

Ingredient ID: NPC278068

Ingredient ID: NPC273547

Ingredient ID: NPC27293

Ingredient ID: NPC272853

Ingredient ID: NPC270750

Ingredient ID: NPC269632

Ingredient ID: NPC269586

Ingredient ID: NPC269206

Ingredient ID: NPC26906

Ingredient ID: NPC268292

Ingredient ID: NPC267509

Ingredient ID: NPC26600

Ingredient ID: NPC264779

Ingredient ID: NPC264197

Ingredient ID: NPC261892

Ingredient ID: NPC261831

Ingredient ID: NPC260130

Ingredient ID: NPC254770

Ingredient ID: NPC250234

Ingredient ID: NPC249407

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC243351

Ingredient ID: NPC2420

Ingredient ID: NPC240993

Ingredient ID: NPC238723

Ingredient ID: NPC237688

Ingredient ID: NPC236579

Ingredient ID: NPC236054

Ingredient ID: NPC233393

Ingredient ID: NPC233231

Ingredient ID: NPC231738

Ingredient ID: NPC230329

Ingredient ID: NPC230070

Ingredient ID: NPC228107

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC226988

Ingredient ID: NPC225822

Ingredient ID: NPC225463

Ingredient ID: NPC22229

Ingredient ID: NPC219750

Ingredient ID: NPC217862

Ingredient ID: NPC216630

Ingredient ID: NPC215649

Ingredient ID: NPC215118

Ingredient ID: NPC214584

Ingredient ID: NPC214367

Ingredient ID: NPC213809

Ingredient ID: NPC212208

Ingredient ID: NPC209970

Ingredient ID: NPC209275

Ingredient ID: NPC208151

Ingredient ID: NPC207549

Ingredient ID: NPC204596

Ingredient ID: NPC200819

Ingredient ID: NPC198586

Ingredient ID: NPC193180

Ingredient ID: NPC191498

Ingredient ID: NPC190810

Ingredient ID: NPC190688

Ingredient ID: NPC189853

Ingredient ID: NPC188334

Ingredient ID: NPC188238

Ingredient ID: NPC187796

Ingredient ID: NPC186324

Ingredient ID: NPC185839

Ingredient ID: NPC180871

Ingredient ID: NPC180398

Ingredient ID: NPC178777

Ingredient ID: NPC178676

Ingredient ID: NPC174006

Ingredient ID: NPC173996

Ingredient ID: NPC170749

Ingredient ID: NPC168323

Ingredient ID: NPC168141

Ingredient ID: NPC167976

Ingredient ID: NPC166577

Ingredient ID: NPC166362

Ingredient ID: NPC165659

Ingredient ID: NPC1656

Ingredient ID: NPC165006

Ingredient ID: NPC16157

Ingredient ID: NPC160996

Ingredient ID: NPC160204

Ingredient ID: NPC159728

Ingredient ID: NPC157603

Ingredient ID: NPC156992

Ingredient ID: NPC154493

Ingredient ID: NPC153858

Ingredient ID: NPC153439

Ingredient ID: NPC15026

Ingredient ID: NPC146943

Ingredient ID: NPC146197

Ingredient ID: NPC144780

Ingredient ID: NPC142703

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC13789

Ingredient ID: NPC136555

Ingredient ID: NPC136248

Ingredient ID: NPC135077

Ingredient ID: NPC131981

Ingredient ID: NPC131946

Ingredient ID: NPC127582

Ingredient ID: NPC127114

Ingredient ID: NPC123934

Ingredient ID: NPC119925

Ingredient ID: NPC117829

Ingredient ID: NPC116679

Ingredient ID: NPC114239

Ingredient ID: NPC110686

Ingredient ID: NPC110405

Ingredient ID: NPC109813

Ingredient ID: NPC108945

Ingredient ID: NPC1075

Ingredient ID: NPC106250

Ingredient ID: NPC104195

Ingredient ID: NPC101285