• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Carex Kobomugi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TGTCGTTGCCTCTTGAAAAACACGACCGTTGCACCCGTGACAGAACCCTGTCGGGGAGGTGCTTGCTGCCTCCTCGGCCCCCCGGCCTCGTCCATCGCGCCCTTCGTGCGAGTTGGATGCCGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAACGCACCGGCCAGCCGCTTAAGGGCTCGCATCGGGTGCTCAGGCCAATAGAAGAAAGTA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO17753
Plant Latin Name: Carex Kobomugi
Taxonomy Genus: Carex
Taxonomy Family: Cyperaceae

Plant External Links:

NCBI TaxonomyDB: 418299
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


2 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

2 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC78681

Ingredient ID: NPC69940

Ingredient ID: NPC68117

Ingredient ID: NPC61370

Ingredient ID: NPC287074

Ingredient ID: NPC271974

Ingredient ID: NPC237554

Ingredient ID: NPC207412

Ingredient ID: NPC202104

Ingredient ID: NPC196681

Ingredient ID: NPC191588

Ingredient ID: NPC142124

Ingredient ID: NPC129078

Ingredient ID: NPC109748