CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Caragana Tibetica

Example Image

PLANiTS DNA barcode

GAACCTGCGGAAGGATCATGTCGATGCCTTACATGCAGACCGACCTGTGAATCTGTTTGAACACGTAGGGCTGGCTTGAGGTGTTCCACGCCTCGACCTCCCTTGAGGTAGGAGGGGGCCACCAGTGCGTTTCCCTGCTGCCTAAACACAAACCCCGGCGCTGAATGCGCCAAGGAACTAAATTTTGTTCAGTGCACCCCTGTTGGCCTGGAGACGGTGCTCCTGCGGGTGGTGTTTTGAAGCATGACACATAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO17706
Plant Latin Name: Caragana Tibetica
Taxonomy Genus: Caragana
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 390503
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

75 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

30 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC9609

Ingredient ID: NPC95460

Ingredient ID: NPC89944

Ingredient ID: NPC8463

Ingredient ID: NPC71715

Ingredient ID: NPC66868

Ingredient ID: NPC59650

Ingredient ID: NPC58716

Ingredient ID: NPC54172

Ingredient ID: NPC52005

Ingredient ID: NPC45367

Ingredient ID: NPC44931

Ingredient ID: NPC42149

Ingredient ID: NPC41979

Ingredient ID: NPC38884

Ingredient ID: NPC34864

Ingredient ID: NPC308289

Ingredient ID: NPC302426

Ingredient ID: NPC299089

Ingredient ID: NPC293588

Ingredient ID: NPC287387

Ingredient ID: NPC282116

Ingredient ID: NPC279525

Ingredient ID: NPC274499

Ingredient ID: NPC26937

Ingredient ID: NPC263251

Ingredient ID: NPC262189

Ingredient ID: NPC261947

Ingredient ID: NPC258104

Ingredient ID: NPC255580

Ingredient ID: NPC255497

Ingredient ID: NPC248573

Ingredient ID: NPC241579

Ingredient ID: NPC224242

Ingredient ID: NPC220518

Ingredient ID: NPC216339

Ingredient ID: NPC21534

Ingredient ID: NPC215317

Ingredient ID: NPC212591

Ingredient ID: NPC210003

Ingredient ID: NPC20836

Ingredient ID: NPC205586

Ingredient ID: NPC20505

Ingredient ID: NPC204443

Ingredient ID: NPC204204

Ingredient ID: NPC203891

Ingredient ID: NPC196209

Ingredient ID: NPC192978

Ingredient ID: NPC189142

Ingredient ID: NPC187206

Ingredient ID: NPC183401

Ingredient ID: NPC182277

Ingredient ID: NPC181465

Ingredient ID: NPC176740

Ingredient ID: NPC176728

Ingredient ID: NPC176300

Ingredient ID: NPC169232

Ingredient ID: NPC165287

Ingredient ID: NPC163508

Ingredient ID: NPC16209

Ingredient ID: NPC160951

Ingredient ID: NPC15659

Ingredient ID: NPC156222

Ingredient ID: NPC153701

Ingredient ID: NPC136014

Ingredient ID: NPC12529

Ingredient ID: NPC123928

Ingredient ID: NPC115275

Ingredient ID: NPC11433

Ingredient ID: NPC113831

Ingredient ID: NPC111742

Ingredient ID: NPC110070

Ingredient ID: NPC109594

Ingredient ID: NPC109024

Ingredient ID: NPC101692

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Therapeutic Target	Enzyme	GFER	FAD-linked sulfhydryl oxidase ALR	P55789	CHEMBL1741189
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	GLO1	Glyoxalase I	Q04760	CHEMBL2424
Therapeutic Target	Oxidoreductase	ALOX5	Arachidonate 5-lipoxygenase	P09917	CHEMBL215
Therapeutic Target	Peptide receptor (family A GPCR)	TSHR	Thyroid stimulating hormone receptor	P16473	CHEMBL1963
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ACHE,KDR,LMNA,TSHR,GLO1,AURKA,GFER,AURKB
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ACHE,LMNA,ALOX5,CYP1B1,AURKA,AURKB,KIT,CYP2C19
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,ALOX5,CYP19A1,AURKB,AURKB,TSHR,ALOX5
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CYP19A1,AURKA,AURKB,AURKA,AURKB,CYP19A1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	AURKA,KIT,KDR,AURKB,ALOX5
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TSHR,ALOX5,GLO1,AURKA,CYP1A2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	KDR,LMNA,ALOX5,AURKA,AURKB
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	KDR,LMNA,TSHR,CYP1B1,CYP19A1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,AURKA,KIT,AURKB,CYP1A2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	ACHE,KDR,ALOX5,GLO1,KIT
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	GLO1,CYP19A1,AURKA,KIT,AURKB
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	AURKA,ALOX5,KIT,KDR
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TSHR,GLO1,CYP19A1,AURKB
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,ALOX5,AURKA,AURKB
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CYP19A1,AURKA,AURKB,KIT
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,TSHR,AURKA,AURKB
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	KDR,AURKA,KIT
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	ALOX5,KIT,KDR
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CYP19A1,AURKA,KDR
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AURKA,KDR,AURKB
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AURKA,AURKB,KIT
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB,AURKA NCT01705652
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE,KIT,KDR
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	AURKA,AURKB,CYP19A1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	TSHR,AURKA,AURKB
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE,AURKA,AURKB
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AURKA,AURKB,CYP1A2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE,CYP1A1,CYP2C19
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,AURKA,AURKB
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KIT,KDR
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	ALOX5,GLO1
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	KDR,TSHR
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDR,KIT
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KDR,KIT
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	KIT,KDR
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	AURKB,AURKA
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	ALOX5,KIT
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	KIT,KDR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,ALOX5
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	KDR,KIT
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1,TSHR
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE,KIT
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AURKA,AURKB
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE,CYP19A1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AURKA,AURKB
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,LMNA
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,CYP1A1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CYP1B1,ALOX5
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,CYP19A1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,CYP1B1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	AURKA,AURKB
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	KDR
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ALOX5
Malignant intestine neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C0Z	KIT
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	KIT
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	ALOX5
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	KIT
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KDR
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	KIT
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	KDR
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	KIT
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	ALOX5
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	ALOX5
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	KIT
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	KDR
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	ALOX5
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	KDR
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	KDR
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	ALOX5
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	ALOX5
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	KDR
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	KDR
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	KDR
Hypo-thyroidism Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A00	TSHR
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KIT
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	KDR
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	TSHR
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	AURKB
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	TSHR
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KIT
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	KIT
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Caragana Tibetica

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

75 All known Ingredients in Total

57 Ingredients with Acceptable Bioavailablity

30 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Other specified malignant neoplasms of kidney, except renal pelvis

Hepatocellular carcinoma of liver

Solid tumour/cancer

Serous cystadenoma,borderline malignancy of ovary

Mesothelioma of pleura

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

Lung cancer

Carcinosarcoma of uterus

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Adenocarcinoma of bronchus or lung

Liver cancer

Thrombocytopenia

Breast cancer

Acute diabete complication

Acute myeloid leukaemia

Prostate cancer

Alzheimer disease

Adenocarcinoma of stomach

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of oesophagus

Urothelial carcinoma of bladder

Cytomegaloviral disease

Malignant neoplasms of corpus uteri, unspecified

Gastrointestinal stromal tumour

Influenza

Thyroid cancer

Myelodysplastic syndrome

Renal cell carcinoma

Multiple myeloma

Malignant haematopoietic neoplasm

Postoperative inflammation

Colorectal cancer

Pain, unspecified

Brain cancer

Coeliac disease

Pheochromocytoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

West Nile virus infection

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Systemic lupus erythematosus

Malignant neoplasms of thyroid gland, unspecified

Chikungunya virus disease

Malignant neoplasms of thymus

Invasive carcinoma of breast

Oesophageal/gastroduodenal disorder

Oesophagitis

Peritoneal cancer

Endometriosis

Rheumatoid arthritis

Malignant intestine neoplasm

Bone/articular cartilage neoplasm

Atopic eczema

Mastocytosis

Dementia

Neuropathy