• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pinus Sylvestris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GATCGCTGTTCCACACATTTCCCCCCTTTTTGCGAGGGCGTGGGGCTGGGGGGAGATTGTCCTCTGTTCGAGCCTCCCCCCGTGAGGGGGTTAGACACCTTTGTTTCTCTTTCTCTCGTGCGTTTTTCCTCCTTTTGCCCCTTGGCCTTACATTTGTTGTGGGGGGGTTCCCCCCCTAATCAGATTTGTGCCCGATATTTCGGTAGTACGTGGAAACGACTCTCGGCAACGGATATCTCGNCTCTTGTTCCGATGAAGAACGTACCGAAATGCGATACTTAGTGTGAATTGCAGAATCCCGTGAATCATCGAGTTTTTGAACGCAATTTGCGCCCGAGGCCTCGGTCGAGGGCACGTCTGTCTGGGCGTCGCATCCCATTCAAACGCGCTCCCTGCAATGTGCTAGGGAGCAGCGGAGCTGGTCGTCCGTGCCCCGTGCGGTGCGGTTGGCTGAAATACCTCAAGCGATGTTTCGTGGCGCGCGTCGGCGAGCGGTGATCTTGTCCCCTTGGATGGGCAGTCGGCGTTAGCCGATGCGGGCTTTGTGTGGCATCGCTCGAACTTGCTTTGCTCTCTCTTGTCCTCCCATGGGGTAGGGCGGATTTAGCTCCAACTTT

Click for details-----ITS1

GATCGCTGTTCCACACATTTCCCCCCTTTTTGCGAGGGCGTGGGGCTGGGGGGAGATTGTCCTCTGTTCGAGCCTCCCCCCGTGAGGGGGTTAGACACCTTTGTTTCTCTTTCTCTCGTGCGTTTTTCCTCCTTTTGCCCCTTGGCCTTACATTTGTTGTGGGGGGGTTCCCCCCCTAATCAGATTTGTGCCCGATATTTCGGTAGTACGTGGAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO17593
Plant Latin Name: Pinus Sylvestris
Taxonomy Genus: Pinus
Taxonomy Family: Pinaceae

Plant External Links:

NCBI TaxonomyDB: 3349
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Finland; India; Sweden; China; Spain; Bulgaria

Traditional Medicine System:
Sowa-Rigpa; TCM; Homeopathy


Medicinal Functions:

Antirheumatic; Antiseptic; Aromatherapy; Bach; Balsamic; Diuretic; Expectorant

Geographical Distribution

Turkey; Finland; India; Sweden; China; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

174 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


93 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

68 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC9874

Ingredient ID: NPC95126

Ingredient ID: NPC91386

Ingredient ID: NPC90105

Ingredient ID: NPC86753

Ingredient ID: NPC86438

Ingredient ID: NPC80807

Ingredient ID: NPC80600

Ingredient ID: NPC80374

Ingredient ID: NPC79499

Ingredient ID: NPC79391

Ingredient ID: NPC78946

Ingredient ID: NPC78026

Ingredient ID: NPC77974

Ingredient ID: NPC76296

Ingredient ID: NPC76145

Ingredient ID: NPC72422

Ingredient ID: NPC72017

Ingredient ID: NPC71853

Ingredient ID: NPC70744

Ingredient ID: NPC70100

Ingredient ID: NPC68779

Ingredient ID: NPC68617

Ingredient ID: NPC68014

Ingredient ID: NPC67571

Ingredient ID: NPC66399

Ingredient ID: NPC65942

Ingredient ID: NPC64123

Ingredient ID: NPC58841

Ingredient ID: NPC58190

Ingredient ID: NPC57788

Ingredient ID: NPC50763

Ingredient ID: NPC48744

Ingredient ID: NPC48107

Ingredient ID: NPC47844

Ingredient ID: NPC43436

Ingredient ID: NPC42676

Ingredient ID: NPC40147

Ingredient ID: NPC39896

Ingredient ID: NPC37468

Ingredient ID: NPC37288

Ingredient ID: NPC36616

Ingredient ID: NPC3649

Ingredient ID: NPC35741

Ingredient ID: NPC33090

Ingredient ID: NPC329043

Ingredient ID: NPC329007

Ingredient ID: NPC32553

Ingredient ID: NPC317758

Ingredient ID: NPC311881

Ingredient ID: NPC307574

Ingredient ID: NPC307506

Ingredient ID: NPC307110

Ingredient ID: NPC307050

Ingredient ID: NPC299937

Ingredient ID: NPC299856

Ingredient ID: NPC299529

Ingredient ID: NPC297727

Ingredient ID: NPC297011

Ingredient ID: NPC29598

Ingredient ID: NPC295946

Ingredient ID: NPC294952

Ingredient ID: NPC293908

Ingredient ID: NPC293017

Ingredient ID: NPC292722

Ingredient ID: NPC291789

Ingredient ID: NPC290016

Ingredient ID: NPC289688

Ingredient ID: NPC288436

Ingredient ID: NPC287301

Ingredient ID: NPC280642

Ingredient ID: NPC278434

Ingredient ID: NPC273991

Ingredient ID: NPC269613

Ingredient ID: NPC268862

Ingredient ID: NPC268342

Ingredient ID: NPC263281

Ingredient ID: NPC26314

Ingredient ID: NPC261093

Ingredient ID: NPC26080

Ingredient ID: NPC251102

Ingredient ID: NPC250482

Ingredient ID: NPC249340

Ingredient ID: NPC246581

Ingredient ID: NPC246202

Ingredient ID: NPC246162

Ingredient ID: NPC246005

Ingredient ID: NPC244776

Ingredient ID: NPC244442

Ingredient ID: NPC243728

Ingredient ID: NPC242898

Ingredient ID: NPC241784

Ingredient ID: NPC238809

Ingredient ID: NPC237207

Ingredient ID: NPC23682

Ingredient ID: NPC23678

Ingredient ID: NPC236202

Ingredient ID: NPC232375

Ingredient ID: NPC232227

Ingredient ID: NPC228346

Ingredient ID: NPC227632

Ingredient ID: NPC224390

Ingredient ID: NPC223834

Ingredient ID: NPC222001

Ingredient ID: NPC219876

Ingredient ID: NPC219480

Ingredient ID: NPC218943

Ingredient ID: NPC218792

Ingredient ID: NPC217650

Ingredient ID: NPC215647

Ingredient ID: NPC212866

Ingredient ID: NPC211336

Ingredient ID: NPC210532

Ingredient ID: NPC21002

Ingredient ID: NPC206280

Ingredient ID: NPC203719

Ingredient ID: NPC197285

Ingredient ID: NPC191327

Ingredient ID: NPC191271

Ingredient ID: NPC188238

Ingredient ID: NPC18816

Ingredient ID: NPC187272

Ingredient ID: NPC187169

Ingredient ID: NPC186616

Ingredient ID: NPC185768

Ingredient ID: NPC182453

Ingredient ID: NPC18229

Ingredient ID: NPC181664

Ingredient ID: NPC178919

Ingredient ID: NPC178815

Ingredient ID: NPC178582

Ingredient ID: NPC173883

Ingredient ID: NPC172469

Ingredient ID: NPC172195

Ingredient ID: NPC169468

Ingredient ID: NPC165219

Ingredient ID: NPC163332

Ingredient ID: NPC163326

Ingredient ID: NPC163191

Ingredient ID: NPC162521

Ingredient ID: NPC15658

Ingredient ID: NPC156304

Ingredient ID: NPC15518

Ingredient ID: NPC15482

Ingredient ID: NPC153854

Ingredient ID: NPC152600

Ingredient ID: NPC151439

Ingredient ID: NPC150361

Ingredient ID: NPC148615

Ingredient ID: NPC148174

Ingredient ID: NPC142871

Ingredient ID: NPC141733

Ingredient ID: NPC140201

Ingredient ID: NPC139397

Ingredient ID: NPC138370

Ingredient ID: NPC138113

Ingredient ID: NPC130754

Ingredient ID: NPC13033

Ingredient ID: NPC128248

Ingredient ID: NPC12640

Ingredient ID: NPC125665

Ingredient ID: NPC116272

Ingredient ID: NPC114239

Ingredient ID: NPC113614

Ingredient ID: NPC112959

Ingredient ID: NPC111929

Ingredient ID: NPC111275

Ingredient ID: NPC111212

Ingredient ID: NPC108811

Ingredient ID: NPC107815

Ingredient ID: NPC10716

Ingredient ID: NPC107091

Ingredient ID: NPC100844

Ingredient ID: NPC100340

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 19 CYP19A1 Cytochrome P450 19A1 P11511 CHEMBL1978
Therapeutic Target Enzyme KARS1 Lysyl-tRNA synthetase Q15046 CHEMBL5575
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Oxidoreductase HSD17B3 Estradiol 17-beta-dehydrogenase 3 P37058 CHEMBL4234
Therapeutic Target Oxidoreductase ALDH1A1 Aldehyde dehydrogenase 1A1 P00352 CHEMBL3577
Therapeutic Target Peptide receptor (family A GPCR) NPSR1 Neuropeptide S receptor Q6W5P4 CHEMBL5162
Therapeutic Target Transcription factor TP53 Cellular tumor antigen p53 P04637 CHEMBL4096
Therapeutic Target Unclassified protein SNCA Alpha-synuclein P37840 CHEMBL6152
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level3
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT05432284 Behavioral Pharmacology of THC and Beta-Myrcene cannabis dependence Myrcene (NPC138113) NP level
NCT04392622 d-Limonene +Radiation +Platinum Based Chemo for Xerostomia Prevention in Locally Advanced Head and Neck Squamous Cell Carcinoma xerostomia Limonene (NPC76145) NP level
NCT04853082 Limonene on Regulating Metabolism-related Fatty Liver Disease (MAFLD) and Analysis of TCM Constitution Hepatic steatosis Limonene (NPC76145) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CA12,TP53,TRIM24,ALDH1A1,SMN1
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA12,CYP19A1,CA12,CYP19A1,TRIM24
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA12,CA7,SNCA,HSD17B3,CYP19A1
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 TP53,NPSR1,CA7,CYP19A1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA12,NPSR1,HSD17B3,CA7
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA12,CA7,SNCA,SMN1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA12,NPSR1,SNCA,SMN1
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CA12,CYP19A1,TRIM24
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 SNCA,NPSR1,CA7
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,NPSR1,CA7
Muscular atrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B61
 SMN1,SMN2
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA12,CYP19A1
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 TP53,CA12
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA12,TP53
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 NPSR1,CYP19A1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 NPSR1,HSD17B3
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CYP19A1,HSD17B3
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12,CA7
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CA12,CYP19A1
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 TP53
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 TP53
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 CYP19A1
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 TP53
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 TP53
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 TP53
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Autonomic nervous system disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D87
 SNCA
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 TP53
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 TP53
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 TP53
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 TP53
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ALDH1A1
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 TP53
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 TP53
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 TP53
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 TP53
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 SNCA
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 TP53
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 SNCA
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 TP53
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1
Cannabis use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C41
 NCT05432284
Other specified non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92.Y
 NCT04853082
Xerostomia
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA02.1
 NCT04392622
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 SNCA
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 TP53
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 CYP19A1
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 NPSR1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 ALDH1A1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 SNCA
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 NPSR1
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 HSD17B3
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 HSD17B3
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 NPSR1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 CYP19A1
Parkinson disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00.0
 ALDH1A1
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 TRIM24
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA12

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group