• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hydrodictyon Reticulatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

TGACACCTCACTCCCATACCTTTTGGTATCATGCATCGGGCCAAGGCTTGATGCTGGGTGTGGATCTGGCTTCCCCAGGGCTACTCTGGGTTGGCTGAAGTGCAGAGGCTAGAGCACGGACCCATATGGGCGTCAACTGGATAGGTAGCCCCCACGCAAGTGGATCTACACGAAGTTGTCTGCCTGGGAGACGTGTTGGCGGCCAAACAGGAAACTTCTCTCA
Taxonomic Information

Plant ID: NPO17557
Plant Latin Name: Hydrodictyon Reticulatum
Taxonomy Genus: Hydrodictyon
Taxonomy Family: Hydrodictyaceae

Plant External Links:

NCBI TaxonomyDB: 3107
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


15 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC83032

Ingredient ID: NPC40511

Ingredient ID: NPC309330

Ingredient ID: NPC265319

Ingredient ID: NPC246534

Ingredient ID: NPC243319

Ingredient ID: NPC237812

Ingredient ID: NPC226453

Ingredient ID: NPC20535

Ingredient ID: NPC174020

Ingredient ID: NPC163099

Ingredient ID: NPC15566

Ingredient ID: NPC13625

Ingredient ID: NPC136014

Ingredient ID: NPC112890

Ingredient ID: NPC111132