• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ribes Nigrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCCTAGCAGAACGACCCGTGAACACGTAGTTATCAACGGGGGTGTCCCCCCTGTGTCGGGCTGTGCTCGGTTCTGCATTGTCTTTCGAGGCGGTGTTGCGATCGTGCGCTCCCGGCAAACACAACGAACCCCGGCGCAAATTGCGCCAAGGAAATATAAAGAAGGAGCATACCCCCGACACCTTCGTGTCGGACAAGGGCGTGTCATCTTTGATGTCTTTAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATTCGGCCGAAGGCACGTCTGCCTGGGCGTCAAGTACCCAATCGTTCCCCCAAACCTCCCACATTTTTACCGATTTGTGGACGGCTCGGAGGGCGGAGATTGGCCTCCCGTGCTGTAACGGCGCGGATGGCCTAAAAGCAAAGCATCGAGCGACGAAACGTCACGACAAGTGGTGGTTGATAAAGCCCTAGCGGCAGCCGCATCGTGTCGTGTGCGTCCAGTCGCGTTCGATAGCACAACGACCCCTACACGTCTCGACGAATTCTG

Click for details-----ITS1

TCGATACCTGCCTAGCAGAACGACCCGTGAACACGTAGTTATCAACGGGGGTGTCCCCCCTGTGTCGGGCTGTGCTCGGTTCTGCATTGTCTTTCGAGGCGGTGTTGCGATCGTGCGCTCCCGGCAAACACAACGAACCCCGGCGCAAATTGCGCCAAGGAAATATAAAGAAGGAGCATACCCCCGACACCTTCGTGTCGGACAAGGGCGTGTCATCTTTGATGTCTTTAA

Click for details-----ITS2

TACCCAATCGTTCCCCCAAACCTCCCACATTTTTACCGATTTGTGGACGGCTCGGAGGGCGGAGATTGGCCTCCCGTGCTGTAACGGCGCGGATGGCCTAAAAGCAAAGCATCGAGCGACGAAACGTCACGACAAGTGGTGGTTGATAAAGCCCTAGCGGCAGCCGCATCGTGTCGTGTGCGTCCAGTCGCGTTCGATAGCACAACGACCCCTACACGTCTCGACGAATTCTG
Taxonomic Information

Plant ID: NPO1751
Plant Latin Name: Ribes Nigrum
Taxonomy Genus: Ribes
Taxonomy Family: Grossulariaceae

Plant External Links:

NCBI TaxonomyDB: 78511
Plant-of-the-World-Online: 792873-1

Used in Medicines

Country/Region:
Lebanon; Finland; India; Russia; China

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antidiarrhoeal; Antirheumatic; Diaphoretic; Diuretic; Febrifuge; Miscellany

Geographical Distribution

Italy; India; France; Ireland; Norway; Belarus; China; Belgium; Germany; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Sweden; Switzerland; Russia; Bulgaria; Romania; South Africa; Lebanon; United Kingdom; Austria; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

162 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


84 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

84 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98356

Ingredient ID: NPC96576

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93633

Ingredient ID: NPC90112

Ingredient ID: NPC8962

Ingredient ID: NPC88566

Ingredient ID: NPC87439

Ingredient ID: NPC85813

Ingredient ID: NPC84955

Ingredient ID: NPC84908

Ingredient ID: NPC81010

Ingredient ID: NPC77672

Ingredient ID: NPC76145

Ingredient ID: NPC75521

Ingredient ID: NPC72527

Ingredient ID: NPC71141

Ingredient ID: NPC69445

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC60761

Ingredient ID: NPC60151

Ingredient ID: NPC55412

Ingredient ID: NPC5447

Ingredient ID: NPC54435

Ingredient ID: NPC5413

Ingredient ID: NPC491218

Ingredient ID: NPC490454

Ingredient ID: NPC490453

Ingredient ID: NPC490438

Ingredient ID: NPC490435

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490408

Ingredient ID: NPC490392

Ingredient ID: NPC490352

Ingredient ID: NPC490322

Ingredient ID: NPC490242

Ingredient ID: NPC490188

Ingredient ID: NPC490160

Ingredient ID: NPC489907

Ingredient ID: NPC489902

Ingredient ID: NPC424

Ingredient ID: NPC41676

Ingredient ID: NPC39426

Ingredient ID: NPC37793

Ingredient ID: NPC37468

Ingredient ID: NPC3649

Ingredient ID: NPC34908

Ingredient ID: NPC34764

Ingredient ID: NPC34241

Ingredient ID: NPC33908

Ingredient ID: NPC328447

Ingredient ID: NPC32674

Ingredient ID: NPC322752

Ingredient ID: NPC317291

Ingredient ID: NPC317120

Ingredient ID: NPC316518

Ingredient ID: NPC314329

Ingredient ID: NPC313179

Ingredient ID: NPC307517

Ingredient ID: NPC300017

Ingredient ID: NPC299529

Ingredient ID: NPC29883

Ingredient ID: NPC296337

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293378

Ingredient ID: NPC290319

Ingredient ID: NPC284720

Ingredient ID: NPC281131

Ingredient ID: NPC280943

Ingredient ID: NPC278068

Ingredient ID: NPC277867

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC268862

Ingredient ID: NPC265305

Ingredient ID: NPC264145

Ingredient ID: NPC261831

Ingredient ID: NPC259293

Ingredient ID: NPC255042

Ingredient ID: NPC251501

Ingredient ID: NPC251256

Ingredient ID: NPC247266

Ingredient ID: NPC243990

Ingredient ID: NPC242580

Ingredient ID: NPC240431

Ingredient ID: NPC237365

Ingredient ID: NPC229415

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC22229

Ingredient ID: NPC221903

Ingredient ID: NPC219876

Ingredient ID: NPC216105

Ingredient ID: NPC2121

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC201284

Ingredient ID: NPC200561

Ingredient ID: NPC199072

Ingredient ID: NPC198658

Ingredient ID: NPC197087

Ingredient ID: NPC195265

Ingredient ID: NPC194861

Ingredient ID: NPC194081

Ingredient ID: NPC190974

Ingredient ID: NPC189436

Ingredient ID: NPC188238

Ingredient ID: NPC187770

Ingredient ID: NPC184643

Ingredient ID: NPC184560

Ingredient ID: NPC180871

Ingredient ID: NPC179950

Ingredient ID: NPC17810

Ingredient ID: NPC178026

Ingredient ID: NPC176740

Ingredient ID: NPC176730

Ingredient ID: NPC175987

Ingredient ID: NPC174246

Ingredient ID: NPC169749

Ingredient ID: NPC168855

Ingredient ID: NPC168579

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC161700

Ingredient ID: NPC161393

Ingredient ID: NPC160789

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC149821

Ingredient ID: NPC149198

Ingredient ID: NPC14867

Ingredient ID: NPC147983

Ingredient ID: NPC147156

Ingredient ID: NPC142103

Ingredient ID: NPC140454

Ingredient ID: NPC137958

Ingredient ID: NPC137887

Ingredient ID: NPC136531

Ingredient ID: NPC133671

Ingredient ID: NPC131372

Ingredient ID: NPC130683

Ingredient ID: NPC126741

Ingredient ID: NPC125755

Ingredient ID: NPC121373

Ingredient ID: NPC119866

Ingredient ID: NPC116775

Ingredient ID: NPC115216

Ingredient ID: NPC114648

Ingredient ID: NPC114517

Ingredient ID: NPC11433

Ingredient ID: NPC114239

Ingredient ID: NPC11119

Ingredient ID: NPC109813

Ingredient ID: NPC108455

Ingredient ID: NPC107840

Ingredient ID: NPC106381