• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Prunella Vulgaris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GCGGAAGGAYCATTGTCGAAACCTGCAAAAGCAGACCGCGAACACGTGCTTAACAACACGGCGCGCGGCGCGGGGACGCGAGTCTCCCCGTCGTGCGACGAATCCCCGCCGGCGCGCTCCCTCGGGTCGCGTCGTTCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTTAACGAAGCGTCCGCATCCCTGCAGCCCGTCCGCGGAACCTGCGGGGGGACCGGTCGTCTATCATAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCACCTCACCGCGCACCAACGTGCCGGCGAGTGGGGCGGATATTGGCCCCCCGTGCGCCTCGGCGCGCGGTCGGCCCAAATGCGATCCCTCGGCGACTCGTGTCGCGACAAGTGGTGGTTGAACCTCAATCTCTCAATCGTCGTGCTCCCGCGTCGTCAGTAAGGGCATCAATGAACGACCCAACGGTGTTGGTGCCGCACGGCACCCCACCTTCGACCGCGACCCCAGGT

Click for details-----ITS1

GCGGAAGGAYCATTGTCGAAACCTGCAAAAGCAGACCGCGAACACGTGCTTAACAACACGGCGCGCGGCGCGGGGACGCGAGTCTCCCCGTCGTGCGACGAATCCCCGCCGGCGCGCTCCCTCGGGTCGCGTCGTTCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTTAACGAAGCGTCCGCATCCCTGCAGCCCGTCCGCGGAACCTGCGGGGGGACCGGTCGTCTATCATAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCACCTCACCGCGCACCAACGTGCCGGCGAGTGGGGCGGATATTGGCCCCCCGTGCGCCTCGGCGCGCGGTCGGCCCAAATGCGATCCCTCGGCGACTCGTGTCGCGACAAGTGGTGGTTGAACCTCAATCTCTCAATCGTCGTGCTCCCGCGTCGTCAGTAAGGGCATCAATGAACGACCCAACGGTGTTGGTGCCGCACGGCACCCCACCTTCGACCGCGACCCCAGGT
Taxonomic Information

Plant ID: NPO17494
Plant Latin Name: Prunella Vulgaris
Taxonomy Genus: Prunella
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 39358
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Finland; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Alterative; Antibacterial; Antibiotic; Antidiarrhoeal; Antipyretic; Antiseptic; Antispasmodic; Astringent; Carminative; Diuretic; Febrifuge; Hypotensive; Stomachic; Styptic; Tonic; Vermifuge; Vulnerary

Geographical Distribution

India; Finland; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

120 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

59 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95090

Ingredient ID: NPC93503

Ingredient ID: NPC93241

Ingredient ID: NPC88789

Ingredient ID: NPC84319

Ingredient ID: NPC836

Ingredient ID: NPC81010

Ingredient ID: NPC79520

Ingredient ID: NPC7947

Ingredient ID: NPC79407

Ingredient ID: NPC78551

Ingredient ID: NPC74855

Ingredient ID: NPC73453

Ingredient ID: NPC70744

Ingredient ID: NPC70388

Ingredient ID: NPC68889

Ingredient ID: NPC67761

Ingredient ID: NPC66769

Ingredient ID: NPC63126

Ingredient ID: NPC62469

Ingredient ID: NPC61

Ingredient ID: NPC53545

Ingredient ID: NPC52021

Ingredient ID: NPC51758

Ingredient ID: NPC51700

Ingredient ID: NPC49615

Ingredient ID: NPC478264

Ingredient ID: NPC478263

Ingredient ID: NPC45727

Ingredient ID: NPC43728

Ingredient ID: NPC40552

Ingredient ID: NPC32977

Ingredient ID: NPC328825

Ingredient ID: NPC327117

Ingredient ID: NPC323787

Ingredient ID: NPC322726

Ingredient ID: NPC322523

Ingredient ID: NPC318892

Ingredient ID: NPC318785

Ingredient ID: NPC317652

Ingredient ID: NPC317111

Ingredient ID: NPC311666

Ingredient ID: NPC307335

Ingredient ID: NPC302857

Ingredient ID: NPC29976

Ingredient ID: NPC298886

Ingredient ID: NPC295777

Ingredient ID: NPC295700

Ingredient ID: NPC294902

Ingredient ID: NPC293343

Ingredient ID: NPC290613

Ingredient ID: NPC290191

Ingredient ID: NPC29

Ingredient ID: NPC288537

Ingredient ID: NPC288089

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC278976

Ingredient ID: NPC277907

Ingredient ID: NPC275463

Ingredient ID: NPC272343

Ingredient ID: NPC26960

Ingredient ID: NPC264711

Ingredient ID: NPC259733

Ingredient ID: NPC258672

Ingredient ID: NPC255662

Ingredient ID: NPC255463

Ingredient ID: NPC246708

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC2421

Ingredient ID: NPC230301

Ingredient ID: NPC227363

Ingredient ID: NPC226794

Ingredient ID: NPC222084

Ingredient ID: NPC218355

Ingredient ID: NPC218109

Ingredient ID: NPC215894

Ingredient ID: NPC212607

Ingredient ID: NPC211801

Ingredient ID: NPC210215

Ingredient ID: NPC209279

Ingredient ID: NPC20791

Ingredient ID: NPC207325

Ingredient ID: NPC205600

Ingredient ID: NPC205579

Ingredient ID: NPC199052

Ingredient ID: NPC197066

Ingredient ID: NPC196561

Ingredient ID: NPC196070

Ingredient ID: NPC195019

Ingredient ID: NPC194586

Ingredient ID: NPC194416

Ingredient ID: NPC189142

Ingredient ID: NPC184078

Ingredient ID: NPC18074

Ingredient ID: NPC179950

Ingredient ID: NPC1788

Ingredient ID: NPC176740

Ingredient ID: NPC171495

Ingredient ID: NPC1682

Ingredient ID: NPC167976

Ingredient ID: NPC167289

Ingredient ID: NPC163866

Ingredient ID: NPC158371

Ingredient ID: NPC156654

Ingredient ID: NPC142753

Ingredient ID: NPC142415

Ingredient ID: NPC138932

Ingredient ID: NPC138113

Ingredient ID: NPC135088

Ingredient ID: NPC133671

Ingredient ID: NPC130577

Ingredient ID: NPC129165

Ingredient ID: NPC117193

Ingredient ID: NPC116794

Ingredient ID: NPC113733

Ingredient ID: NPC112866

Ingredient ID: NPC108494

Ingredient ID: NPC1075