CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Setaria Italica

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTGAAGGAGGAAGTCGTAACAAGGTTTTCTGTAGGTGGAACCTCGGAAGGATTCATTGTCGTGACCCTTAAACAAAACAGACCGTGAACATGTCATCCATCCCGCACGTGGTTCTACCCGTGCAAGGCCCCGACCTTTCCGAAGGAGAGGGGCCGCAAAAGAACCCACGGCGCCGAAGGCGTCAAGGAAAACTGATATTGCCTTGCTCGGGGCTGTGCTCGGCTTGCCGAGCACACCTCGTGCAGCGATGCTATCTTAATCCACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGTTGAGGGCACGCCTGCCTGGGCGTCACGCCAAAAGACACTCCCAACCCAAACCTGGGGAAGGACGTGGTGTTTGGCTCCCCGTGCTGCAAGGCGCGGTGGGCCGAAGTTTGGGCTGCCGGCATAACTTGTCGGGCACCGCACGTGGTGGGCGACATCTAGTTGTTCTCGGTGCAGTGTCCTGGCATGCAGCTGGCTTATTGGCCTCAAGGACCCATACACGACCGAAGCGTTTAGGCGCTCTGGACTAGTGACGCACAGTCATGA

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO17452
Plant Latin Name: Setaria Italica
Taxonomy Genus: Setaria
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 4555
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

22 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

3 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98449

Ingredient ID: NPC82969

Ingredient ID: NPC65547

Ingredient ID: NPC49212

Ingredient ID: NPC324035

Ingredient ID: NPC312523

Ingredient ID: NPC310720

Ingredient ID: NPC28446

Ingredient ID: NPC281457

Ingredient ID: NPC272113

Ingredient ID: NPC239280

Ingredient ID: NPC231149

Ingredient ID: NPC22736

Ingredient ID: NPC221442

Ingredient ID: NPC194342

Ingredient ID: NPC19074

Ingredient ID: NPC18188

Ingredient ID: NPC163377

Ingredient ID: NPC162555

Ingredient ID: NPC1432

Ingredient ID: NPC131586

Ingredient ID: NPC104537

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Enzyme	BLM	Bloom syndrome protein	P54132	CHEMBL1293237
Therapeutic Target	GABA-A receptor	GABRR1	GABA receptor rho-1 subunit	P24046	CHEMBL3561
Therapeutic Target	Protein methyltransferase	KMT2A	Histone-lysine N-methyltransferase MLL	Q03164	CHEMBL1293299

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02002130	The Use of Glutamic Acid Decarboxylase (GAD) and Gamma-Amino Butyric Acid (GABA) in the Treatment of Type I Diabetes	type 1 diabetes mellitus	Gamma-Aminobutyric Acid (NPC18188)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	SLC6A11,GABRA2,GABBR2,BLM,GABRA3,GABRA3,SLC6A11,GABBR2,GABRA2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	GABRA2,GABBR2,GABRB2,GABRA5,SLC6A11,GABRG2,GABRA3
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	SLC6A11,SLC6A12,GABBR2,GABRA5,GABRA3,GABRR1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	SLC6A11,GABRA2,BLM,GABRA5,GABRA3,GABRR1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	LMNA,GABRA2,GABBR2,BLM,GABRA3,GABRR1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	SLC6A11,GABBR2,BLM,GABRA5,GABRA3,GABRR1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	SLC6A11,CYP3A4,GABBR2,BLM,GABRA5,GABRA3
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	GABRA2,GABBR2,GABRA5,GABRA3,GABRR1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	SLC6A11,BLM,GABRA5,GABRA3,GABRR1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SLC6A11,LMNA,GABRA2,GABRA5,GABRA3
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	SLC6A11,LMNA,GABBR2,BLM
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	SLC6A11,BLM,GABRA3,GABRR1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	GABRA2,SLC6A12,GABRA5,GABRR1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP3A4,GABRA5,GABRA3,GABRR1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	GABBR2,BLM,GABRA5,GABRA3
Epilepsy/seizure Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A61-8A6Z	GABRG2,GABBR2,GABRB2
Intentional self-harm Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PC91	GABRA5,GABRA2,GABRA3
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	BLM,GABRA3,GABRR1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP3A4,BLM,GABBR2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA,BLM,GABRR1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	BLM,GABRA5,GABRA3
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	GABRA5,GABBR2
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	GABRG2,GABRB2
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	GABRA3,CYP3A4
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CYP3A4,GABBR2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	SLC6A12,BLM
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	LMNA,BLM
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	GABBR2,GABBR2
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	GABRA3,SLC6A11
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,GABRA5
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	GABRA3,BLM
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	SLC6A12,SLC6A11
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	GABRA6,GABBR2
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	GABBR2,GABRA2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	BLM,GABRR1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	SLC6A11,LMNA
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GABBR2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	GABRA5
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	GABBR2
Sex development malformative disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2A	GABRA5
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	GABBR2
Adaptive immunity immunodeficiency Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A01	GABRA5
Sleep-wake disorder Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7B2Z	GABRA3
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	GABRA5
Narcolepsy Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A20	GABBR2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	GABBR2
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CYP3A4
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	GABRB2
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	GABBR2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	GABBR2
Type1diabetesmellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10	NCT02002130
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	GABRA5
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	SLC6A12
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	GABBR2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP3A4
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	SLC6A12
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	BLM

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Setaria Italica

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

22 All known Ingredients in Total

11 Ingredients with Acceptable Bioavailablity

3 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Hepatocellular carcinoma of liver

Indeterminate colitis

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Adenocarcinoma of pancreas

Adenocarcinoma of bronchus or lung

Malignant neoplasms of adrenal gland

Carcinosarcoma of uterus

Squamous cell carcinoma of bronchus or lung

Mesothelioma of pleura

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Melanoma of skin

Malignant neoplasms of thymus

Invasive carcinoma of breast

Epilepsy/seizure

Intentional self-harm

Adenocarcinoma of stomach

Urothelial carcinoma of bladder

Glioblastoma of brain

Germ cell tumour of testis

Autism spectrum disorder

Tonus and reflex abnormality

Anxiety

Solid tumour/cancer

Leishmaniasis

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Cytomegaloviral disease

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of stomach

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Fragile X chromosome

Alzheimer disease

Substance abuse

Sex development malformative disorder

Chronic pain

Adaptive immunity immunodeficiency

Sleep-wake disorder

Mild neurocognitive disorder

Narcolepsy

Schizophrenia

Atopic eczema

Insomnia

Multiple sclerosis

Depression

Type1diabetesmellitus

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Tetralogy of Fallot

Chronic rhinosinusitis

Renal cell carcinoma, chromophobe type

Carpal tunnel syndrome

Gliomas of brain

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities