• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vernonia Profuga


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GAATGCCGCATTATAAATGACTTGTGAACACGTTAAAAACCAGGGATGGTGTCATGGGCTCTAGCCGGTGACTCTATGCCTTGCTAACAGACATTTATGATGCTTGTAATRTATTTGTAGATGTCTTGTTGGCACCAAAACAAACCCCGGCACGGACCGTGCCAAGGAAAATAAAAGATAAGAAAGTTGTGGCTCGTGATGTTTTTCATTCGGGTATCCAACCTTCAAAAACATAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO17431
Plant Latin Name: Vernonia Profuga
Taxonomy Genus: Vernonia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 434704
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

22 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88278

Ingredient ID: NPC8198

Ingredient ID: NPC79056

Ingredient ID: NPC75532

Ingredient ID: NPC74881

Ingredient ID: NPC56671

Ingredient ID: NPC308326

Ingredient ID: NPC293908

Ingredient ID: NPC286233

Ingredient ID: NPC275394

Ingredient ID: NPC27532

Ingredient ID: NPC26974

Ingredient ID: NPC241838

Ingredient ID: NPC224651

Ingredient ID: NPC209296

Ingredient ID: NPC1940

Ingredient ID: NPC182541

Ingredient ID: NPC172763

Ingredient ID: NPC1591

Ingredient ID: NPC136014

Ingredient ID: NPC125732

Ingredient ID: NPC107135