• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Benincasa Hispida


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ATGCCTAAACATCAAACGACCCGCGAACACGTTTAAGAACAAACTGTTCGCGTCGAGGGCGGGGGGGAAGCATGCTCTTTGCCTGCCCCCCCTCCCCCTCGACGCGCTTAAACCAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATCTGCCTGCCCCTTGCCCCGGCCTCGGTGTGCGGGGGGTGGAGCATTCTTGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCTCCACACAACTCGTTGTGCAGGCGGGGGCACATGTTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCACGTCGTCGCGACACTACGGTGGTTGATCCAACCTCAGTACCATGTCGCGGCCTCGACCCCGCCTCCACGGACTCATGCATTGACCCTCTGAGCGTTGTACCCGAAAGGATGGCGCTCTCGACGCGACCCCAGGTCAGGCGGGACTAC

Click for details-----ITS1

TTGATGCCTAAACATCAAACGACCCGCGAACACGTTTAAGAACAAACTGTTCGCGTCGAGGGCGGGGGGGAAGCATGCTCTTTGCCTGCCCCCCCCTCCCCCCTCGACGCGCTTAAACCAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATCTGCCTGCCCCTTGCCCCGGCCTCGGTGTGCGGGGGGTGGAGCATTCTTGTCGTATTACTCACAA

Click for details-----ITS2

ATCGCTGCCCCCCTCCACACAACTCGTTGTGCAGGCGGGGGCACATGTTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCACGTCGTCGCGACACTACGGTGGTTGATCCAACCTCAGTACCATGTCGCGGCCTCGACCCCGCCTCCACGGACTCATGCATTGACCCTCTGAGCGTTGTACCCGAAAGGATGGCGCTCTCGACGCGACCCCAGGTCAGGCGGGACTAC
Taxonomic Information

Plant ID: NPO17336
Plant Latin Name: Benincasa Hispida
Taxonomy Genus: Benincasa
Taxonomy Family: Cucurbitaceae

Plant External Links:

NCBI TaxonomyDB: 102211
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; Indonesia; India; China

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM


Medicinal Functions:

Anthelmintic; Antiperiodic; Aphrodisiac; Cancer; Demulcent; Diuretic; Expectorant; Febrifuge; Laxative; Salve; Tonic; VD

Geographical Distribution

India; Indonesia; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

164 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


103 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

84 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98777

Ingredient ID: NPC98583

Ingredient ID: NPC94583

Ingredient ID: NPC94167

Ingredient ID: NPC92117

Ingredient ID: NPC91409

Ingredient ID: NPC91239

Ingredient ID: NPC90701

Ingredient ID: NPC87828

Ingredient ID: NPC86947

Ingredient ID: NPC8651

Ingredient ID: NPC85813

Ingredient ID: NPC85270

Ingredient ID: NPC84279

Ingredient ID: NPC78946

Ingredient ID: NPC76145

Ingredient ID: NPC76128

Ingredient ID: NPC76112

Ingredient ID: NPC75097

Ingredient ID: NPC70622

Ingredient ID: NPC69071

Ingredient ID: NPC68953

Ingredient ID: NPC66913

Ingredient ID: NPC63027

Ingredient ID: NPC62086

Ingredient ID: NPC57380

Ingredient ID: NPC52370

Ingredient ID: NPC5029

Ingredient ID: NPC49074

Ingredient ID: NPC489907

Ingredient ID: NPC44260

Ingredient ID: NPC424

Ingredient ID: NPC41080

Ingredient ID: NPC39333

Ingredient ID: NPC38851

Ingredient ID: NPC36959

Ingredient ID: NPC36490

Ingredient ID: NPC36061

Ingredient ID: NPC36002

Ingredient ID: NPC35344

Ingredient ID: NPC328447

Ingredient ID: NPC317201

Ingredient ID: NPC313047

Ingredient ID: NPC312929

Ingredient ID: NPC308738

Ingredient ID: NPC305843

Ingredient ID: NPC304452

Ingredient ID: NPC301585

Ingredient ID: NPC301384

Ingredient ID: NPC299964

Ingredient ID: NPC294548

Ingredient ID: NPC288411

Ingredient ID: NPC288089

Ingredient ID: NPC282923

Ingredient ID: NPC278525

Ingredient ID: NPC278329

Ingredient ID: NPC271385

Ingredient ID: NPC269919

Ingredient ID: NPC264779

Ingredient ID: NPC264145

Ingredient ID: NPC261831

Ingredient ID: NPC261147

Ingredient ID: NPC26080

Ingredient ID: NPC259976

Ingredient ID: NPC254847

Ingredient ID: NPC248949

Ingredient ID: NPC248668

Ingredient ID: NPC248520

Ingredient ID: NPC248047

Ingredient ID: NPC247364

Ingredient ID: NPC243728

Ingredient ID: NPC242582

Ingredient ID: NPC242580

Ingredient ID: NPC241055

Ingredient ID: NPC232924

Ingredient ID: NPC232189

Ingredient ID: NPC230301

Ingredient ID: NPC230085

Ingredient ID: NPC229036

Ingredient ID: NPC226803

Ingredient ID: NPC225710

Ingredient ID: NPC22481

Ingredient ID: NPC223951

Ingredient ID: NPC221134

Ingredient ID: NPC218988

Ingredient ID: NPC216752

Ingredient ID: NPC216630

Ingredient ID: NPC216216

Ingredient ID: NPC214251

Ingredient ID: NPC214165

Ingredient ID: NPC211722

Ingredient ID: NPC211608

Ingredient ID: NPC211342

Ingredient ID: NPC209970

Ingredient ID: NPC209011

Ingredient ID: NPC203468

Ingredient ID: NPC199875

Ingredient ID: NPC198865

Ingredient ID: NPC198440

Ingredient ID: NPC197087

Ingredient ID: NPC194677

Ingredient ID: NPC190036

Ingredient ID: NPC189470

Ingredient ID: NPC188563

Ingredient ID: NPC187770

Ingredient ID: NPC186944

Ingredient ID: NPC185072

Ingredient ID: NPC184615

Ingredient ID: NPC181448

Ingredient ID: NPC179024

Ingredient ID: NPC178851

Ingredient ID: NPC17810

Ingredient ID: NPC177465

Ingredient ID: NPC176740

Ingredient ID: NPC175542

Ingredient ID: NPC175313

Ingredient ID: NPC168829

Ingredient ID: NPC168409

Ingredient ID: NPC168255

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166963

Ingredient ID: NPC160512

Ingredient ID: NPC159630

Ingredient ID: NPC159106

Ingredient ID: NPC154920

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149700

Ingredient ID: NPC147983

Ingredient ID: NPC146973

Ingredient ID: NPC146837

Ingredient ID: NPC146197

Ingredient ID: NPC142811

Ingredient ID: NPC142632

Ingredient ID: NPC142063

Ingredient ID: NPC141777

Ingredient ID: NPC141003

Ingredient ID: NPC14079

Ingredient ID: NPC139029

Ingredient ID: NPC138466

Ingredient ID: NPC13789

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC130315

Ingredient ID: NPC128792

Ingredient ID: NPC128457

Ingredient ID: NPC123953

Ingredient ID: NPC122792

Ingredient ID: NPC120635

Ingredient ID: NPC117862

Ingredient ID: NPC116628

Ingredient ID: NPC115723

Ingredient ID: NPC115119

Ingredient ID: NPC114746

Ingredient ID: NPC114526

Ingredient ID: NPC114239

Ingredient ID: NPC113650

Ingredient ID: NPC112890

Ingredient ID: NPC112355

Ingredient ID: NPC109813

Ingredient ID: NPC108455

Ingredient ID: NPC105004

Ingredient ID: NPC101649