• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Valeriana Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAACCTGCGGAAGGATCATTGTCGATGCCTGCACGCGCAGAACGACCCGCGAACACGTTCAAAACCGCGGAGCCCCGGACCCTCGGGCCGTGACTCCGAAGGACGCGGGACCGTAAGGACCCCGCGGCCGCAAACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAACGGAAGGGGCGTGTTGGCCCGATCGGCCCGTTCGCGGTGCCGGCCGGGCGAGCGCCAACCCCTCTGAGAAAAACATAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCTCCCCGCCTCCCCCTCATCGGGGCGCGGCGTGCGGCGGGGGGCGCGGACGATGGCCTCCCGCGCCCTCATCGGGCGCGGCTGGCCTAAAACACGGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCGAAAAGTCCTCTGTTCGCGCCGTGGCCCTCCCCGTCTTCCGGGTGGCGAATCGACCCATACGCGCCGTCCACGAGACTGCGCTCCGACCGCGACCCCAGGTCAG

Click for details-----ITS1

GAACCTGCGGAAGGATCATTGTCGATGCCTGCACGCGCAGAACGACCCGCGAACACGTTCAAAACCGCGGAGCCCCGGACCCTCGGGCCGTGACTCCGAAGGACGCGGGACCGTAAGGACCCCGCGGCCGCAAACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAACGGAAGGGGCGTGTTGGCCCGATCGGCCCGTTCGCGGTGCCGGCCGGGCGAGCGCCAACCCCTCTGAGAAAAACATAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCTCCCCGCCTCCCCCTCATCGGGGCGCGGCGTGCGGCGGGGGGCGCGGACGATGGCCTCCCGCGCCCTCATCGGGCGCGGCTGGCCTAAAACACGGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCGAAAAGTCCTCTGTTCGCGCCGTGGCCCTCCCCGTCTTCCGGGTGGCGAATCGACCCATACGCGCCGTCCACGAGACTGCGCTCCGACCGCGACCCCAGGTCAG
Taxonomic Information

Plant ID: NPO17333
Plant Latin Name: Valeriana Officinalis
Taxonomy Genus: Valeriana
Taxonomy Family: Caprifoliaceae

Plant External Links:

NCBI TaxonomyDB: 19953
Plant-of-the-World-Online: 860012-1

Used in Medicines

Country/Region:
Turkey; Albania; Italy; Estonia; India; Finland; Lithuania; Sweden; China; Switzerland; Indonesia

Traditional Medicine System:
Unani; TCM; Homeopathy; Ayurveda


Medicinal Functions:

Anticonvulsant; Antispasmodic; Carminative; Diuretic; Hypnotic; Nervine; Sedative; Stimulant

Geographical Distribution

Canada; Turkey; Italy; Lithuania; France; Belarus; China; Germany; Ukraine; Indonesia; Denmark; Poland; Finland; United States; Sweden; Switzerland; Russia; Bulgaria; Romania; Albania; Estonia; India; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

197 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


140 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

72 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96399

Ingredient ID: NPC94758

Ingredient ID: NPC90803

Ingredient ID: NPC90184

Ingredient ID: NPC90062

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC8621

Ingredient ID: NPC81907

Ingredient ID: NPC81316

Ingredient ID: NPC80448

Ingredient ID: NPC79571

Ingredient ID: NPC78631

Ingredient ID: NPC7639

Ingredient ID: NPC75158

Ingredient ID: NPC73899

Ingredient ID: NPC7278

Ingredient ID: NPC72506

Ingredient ID: NPC7059

Ingredient ID: NPC68889

Ingredient ID: NPC66504

Ingredient ID: NPC664

Ingredient ID: NPC61954

Ingredient ID: NPC59668

Ingredient ID: NPC58865

Ingredient ID: NPC55233

Ingredient ID: NPC52403

Ingredient ID: NPC51964

Ingredient ID: NPC49126

Ingredient ID: NPC47920

Ingredient ID: NPC475224

Ingredient ID: NPC469919

Ingredient ID: NPC469918

Ingredient ID: NPC46092

Ingredient ID: NPC45317

Ingredient ID: NPC43160

Ingredient ID: NPC41689

Ingredient ID: NPC41348

Ingredient ID: NPC40000

Ingredient ID: NPC38992

Ingredient ID: NPC36922

Ingredient ID: NPC36856

Ingredient ID: NPC3649

Ingredient ID: NPC36352

Ingredient ID: NPC34764

Ingredient ID: NPC34687

Ingredient ID: NPC33406

Ingredient ID: NPC329022

Ingredient ID: NPC328143

Ingredient ID: NPC326098

Ingredient ID: NPC325599

Ingredient ID: NPC325444

Ingredient ID: NPC324849

Ingredient ID: NPC323598

Ingredient ID: NPC322876

Ingredient ID: NPC322305

Ingredient ID: NPC320605

Ingredient ID: NPC319191

Ingredient ID: NPC315877

Ingredient ID: NPC314197

Ingredient ID: NPC313931

Ingredient ID: NPC311935

Ingredient ID: NPC310444

Ingredient ID: NPC30896

Ingredient ID: NPC30654

Ingredient ID: NPC306418

Ingredient ID: NPC305327

Ingredient ID: NPC300342

Ingredient ID: NPC299131

Ingredient ID: NPC297643

Ingredient ID: NPC296558

Ingredient ID: NPC295723

Ingredient ID: NPC294902

Ingredient ID: NPC293343

Ingredient ID: NPC293201

Ingredient ID: NPC291517

Ingredient ID: NPC289143

Ingredient ID: NPC288411

Ingredient ID: NPC287331

Ingredient ID: NPC283995

Ingredient ID: NPC280284

Ingredient ID: NPC278556

Ingredient ID: NPC277205

Ingredient ID: NPC276753

Ingredient ID: NPC273832

Ingredient ID: NPC273607

Ingredient ID: NPC273423

Ingredient ID: NPC26906

Ingredient ID: NPC265411

Ingredient ID: NPC264428

Ingredient ID: NPC263337

Ingredient ID: NPC252635

Ingredient ID: NPC25257

Ingredient ID: NPC25141

Ingredient ID: NPC251104

Ingredient ID: NPC249815

Ingredient ID: NPC246003

Ingredient ID: NPC244949

Ingredient ID: NPC244088

Ingredient ID: NPC24327

Ingredient ID: NPC241202

Ingredient ID: NPC240899

Ingredient ID: NPC238428

Ingredient ID: NPC23695

Ingredient ID: NPC232977

Ingredient ID: NPC231738

Ingredient ID: NPC231410

Ingredient ID: NPC23049

Ingredient ID: NPC230301

Ingredient ID: NPC227730

Ingredient ID: NPC22613

Ingredient ID: NPC223812

Ingredient ID: NPC223700

Ingredient ID: NPC221774

Ingredient ID: NPC221661

Ingredient ID: NPC216144

Ingredient ID: NPC213749

Ingredient ID: NPC211902

Ingredient ID: NPC211074

Ingredient ID: NPC210934

Ingredient ID: NPC210688

Ingredient ID: NPC210450

Ingredient ID: NPC208307

Ingredient ID: NPC207362

Ingredient ID: NPC206955

Ingredient ID: NPC206478

Ingredient ID: NPC205468

Ingredient ID: NPC205125

Ingredient ID: NPC204868

Ingredient ID: NPC204145

Ingredient ID: NPC20306

Ingredient ID: NPC202189

Ingredient ID: NPC201387

Ingredient ID: NPC200505

Ingredient ID: NPC200129

Ingredient ID: NPC194208

Ingredient ID: NPC193180

Ingredient ID: NPC188947

Ingredient ID: NPC188521

Ingredient ID: NPC187870

Ingredient ID: NPC186996

Ingredient ID: NPC184049

Ingredient ID: NPC181540

Ingredient ID: NPC180418

Ingredient ID: NPC180300

Ingredient ID: NPC179297

Ingredient ID: NPC177112

Ingredient ID: NPC174368

Ingredient ID: NPC172066

Ingredient ID: NPC166362

Ingredient ID: NPC164727

Ingredient ID: NPC164706

Ingredient ID: NPC161923

Ingredient ID: NPC160912

Ingredient ID: NPC159362

Ingredient ID: NPC157776

Ingredient ID: NPC157588

Ingredient ID: NPC154792

Ingredient ID: NPC15458

Ingredient ID: NPC153843

Ingredient ID: NPC146423

Ingredient ID: NPC141944

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC138113

Ingredient ID: NPC136330

Ingredient ID: NPC134520

Ingredient ID: NPC130913

Ingredient ID: NPC12870

Ingredient ID: NPC128248

Ingredient ID: NPC126240

Ingredient ID: NPC125269

Ingredient ID: NPC125108

Ingredient ID: NPC12483

Ingredient ID: NPC124588

Ingredient ID: NPC120233

Ingredient ID: NPC119663

Ingredient ID: NPC118968

Ingredient ID: NPC117743

Ingredient ID: NPC117066

Ingredient ID: NPC11540

Ingredient ID: NPC114992

Ingredient ID: NPC114046

Ingredient ID: NPC114014

Ingredient ID: NPC112861

Ingredient ID: NPC112726

Ingredient ID: NPC110396

Ingredient ID: NPC110250

Ingredient ID: NPC109813

Ingredient ID: NPC107662

Ingredient ID: NPC1075

Ingredient ID: NPC107271

Ingredient ID: NPC106047

Ingredient ID: NPC104195

Ingredient ID: NPC10331

Ingredient ID: NPC102895

Ingredient ID: NPC101680