• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Beesia Calthifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAACGACCCGAGAACACGTTAAAAAACATGATATGGATTGAGGAGGGGTGTGAACTCTTAATCATCCATTGTCGGGTCATGGGATCGACCACGGTCGTCGACCTGTGCTCTCGTACAAACACAAAACCCGACGCAATTGGCGTCAAGGAAATCTTAGCGGAAACAAAGTGTCATCCTTTTATAATTGGCGATACTGTGATTCCAATACTCGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACACATAGCGTCGTTCCCAACCAATTTTATTAATTGGGGAAYGGAAATTGGCCCCCCGAGTCCTTTTGGGCACGGTTGGCTCAAATATTGGTCCTCGACGGCAAGTGTCGCGGTCTGYGGTGGTTGTAAACTCATCCCCTAAGACAAAATAAGACGCGTAGCCTTGTCGTCTAACGGACCAACATAACCCTTGGAAGCCGTTCAACGGTGTTCACCCTGCGACCCCAGGTCAGGCG

Click for details-----ITS1

ATAACGACCCGAGAACACGTTAAAAAACATGATATGGATTGAGGAGGGGTGTGAACTCTTAATCATCCATTGTCGGGTCATGGGATCGACCACGGTCGTCGACCTGTGCTCTCGTACAAACACAAAACCCGACGCAATTGGCGTCAAGGAAATCTTAGCGGAAACAAAGTGTCATCCTTTTATAATTGGCGATACTGCGATTCCAATACTCGAA

Click for details-----ITS2

ACAGCGTCGTTCCCCTTCTAATTTTATTGGACTGAGAACGGAGATTGGCTCCCCGAGTCCTTTTGGGCACGGTTGGCTGAAAWATTGGTCCTCGGCGACAAGGGTCGTGGTCAGTGGTGGTTGTAAACTCCTCCCCCAAAGACGAATGAAGACGCGTAGCCTTGTTGCATGTTGGACACACATAACCCTTGGAAACCGTTCAACGGTTTTCACCCTGCGACCCCAGGTCAGGCG
Taxonomic Information

Plant ID: NPO17296
Plant Latin Name: Beesia Calthifolia
Taxonomy Genus: Beesia
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 78478
Plant-of-the-World-Online: 709225-1

Used in Medicines

Unknown.

Geographical Distribution

China; Myanmar

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

125 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


89 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

67 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC83297

Ingredient ID: NPC78790

Ingredient ID: NPC74080

Ingredient ID: NPC7401

Ingredient ID: NPC73818

Ingredient ID: NPC70744

Ingredient ID: NPC69712

Ingredient ID: NPC61985

Ingredient ID: NPC55715

Ingredient ID: NPC473067

Ingredient ID: NPC473066

Ingredient ID: NPC473065

Ingredient ID: NPC473064

Ingredient ID: NPC473063

Ingredient ID: NPC473062

Ingredient ID: NPC45691

Ingredient ID: NPC45242

Ingredient ID: NPC43732

Ingredient ID: NPC43246

Ingredient ID: NPC35961

Ingredient ID: NPC35627

Ingredient ID: NPC31102

Ingredient ID: NPC310532

Ingredient ID: NPC308198

Ingredient ID: NPC305944

Ingredient ID: NPC298912

Ingredient ID: NPC29883

Ingredient ID: NPC291426

Ingredient ID: NPC285315

Ingredient ID: NPC283823

Ingredient ID: NPC283468

Ingredient ID: NPC281056

Ingredient ID: NPC280291

Ingredient ID: NPC278525

Ingredient ID: NPC2770

Ingredient ID: NPC276195

Ingredient ID: NPC275110

Ingredient ID: NPC274613

Ingredient ID: NPC27410

Ingredient ID: NPC271946

Ingredient ID: NPC267396

Ingredient ID: NPC264870

Ingredient ID: NPC261206

Ingredient ID: NPC253746

Ingredient ID: NPC252032

Ingredient ID: NPC251387

Ingredient ID: NPC249194

Ingredient ID: NPC245561

Ingredient ID: NPC243728

Ingredient ID: NPC243469

Ingredient ID: NPC24101

Ingredient ID: NPC24019

Ingredient ID: NPC236443

Ingredient ID: NPC234918

Ingredient ID: NPC230301

Ingredient ID: NPC230214

Ingredient ID: NPC229991

Ingredient ID: NPC22481

Ingredient ID: NPC223956

Ingredient ID: NPC221653

Ingredient ID: NPC220540

Ingredient ID: NPC219913

Ingredient ID: NPC218652

Ingredient ID: NPC214869

Ingredient ID: NPC214001

Ingredient ID: NPC211192

Ingredient ID: NPC210434

Ingredient ID: NPC209177

Ingredient ID: NPC205421

Ingredient ID: NPC204607

Ingredient ID: NPC203719

Ingredient ID: NPC199990

Ingredient ID: NPC199965

Ingredient ID: NPC195058

Ingredient ID: NPC192135

Ingredient ID: NPC190827

Ingredient ID: NPC189903

Ingredient ID: NPC189470

Ingredient ID: NPC184026

Ingredient ID: NPC182326

Ingredient ID: NPC180199

Ingredient ID: NPC179487

Ingredient ID: NPC17814

Ingredient ID: NPC17599

Ingredient ID: NPC175405

Ingredient ID: NPC174726

Ingredient ID: NPC171317

Ingredient ID: NPC167400

Ingredient ID: NPC164706

Ingredient ID: NPC164627

Ingredient ID: NPC161187

Ingredient ID: NPC159418

Ingredient ID: NPC158088

Ingredient ID: NPC155838

Ingredient ID: NPC155098

Ingredient ID: NPC152212

Ingredient ID: NPC152106

Ingredient ID: NPC150368

Ingredient ID: NPC150043

Ingredient ID: NPC14818

Ingredient ID: NPC146694

Ingredient ID: NPC146137

Ingredient ID: NPC145727

Ingredient ID: NPC141765

Ingredient ID: NPC136508

Ingredient ID: NPC135006

Ingredient ID: NPC133862

Ingredient ID: NPC131192

Ingredient ID: NPC130290

Ingredient ID: NPC119535

Ingredient ID: NPC117423

Ingredient ID: NPC117237

Ingredient ID: NPC116349

Ingredient ID: NPC114102

Ingredient ID: NPC113733

Ingredient ID: NPC112575

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110865

Ingredient ID: NPC110396

Ingredient ID: NPC107374

Ingredient ID: NPC107144

Ingredient ID: NPC105501

Ingredient ID: NPC104809

Ingredient ID: NPC101679