• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Chrysanthemum Zawadskii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAAAAACAACCGAGTGTTGAGAGGACCAAGCTCCTGTTTGATCCTCTCGACGCTTTGTCGATGCGCGTTTACTCGAGTTCTTTTGGACCTTGTGAATGTGTCATTGGCGCATTAACAACCCCCGGCACAACGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTTTCATGATGTCCCCGTTCGCGGTGTGCTCATGGGATGTGGCTTCTTTATAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO17295
Plant Latin Name: Chrysanthemum Zawadskii
Taxonomy Genus: Chrysanthemum
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 147003
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea

Traditional Medicine System:

Geographical Distribution

South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

123 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


112 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

47 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC95675

Ingredient ID: NPC91574

Ingredient ID: NPC89069

Ingredient ID: NPC87828

Ingredient ID: NPC86683

Ingredient ID: NPC86564

Ingredient ID: NPC8120

Ingredient ID: NPC76817

Ingredient ID: NPC75158

Ingredient ID: NPC75121

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70793

Ingredient ID: NPC67986

Ingredient ID: NPC67761

Ingredient ID: NPC64176

Ingredient ID: NPC61828

Ingredient ID: NPC61769

Ingredient ID: NPC57471

Ingredient ID: NPC54901

Ingredient ID: NPC54264

Ingredient ID: NPC52230

Ingredient ID: NPC51758

Ingredient ID: NPC51189

Ingredient ID: NPC50450

Ingredient ID: NPC45107

Ingredient ID: NPC44751

Ingredient ID: NPC43822

Ingredient ID: NPC43728

Ingredient ID: NPC43114

Ingredient ID: NPC41348

Ingredient ID: NPC40249

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC3155

Ingredient ID: NPC311485

Ingredient ID: NPC30853

Ingredient ID: NPC308218

Ingredient ID: NPC308108

Ingredient ID: NPC302153

Ingredient ID: NPC301195

Ingredient ID: NPC300649

Ingredient ID: NPC29710

Ingredient ID: NPC294136

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC288932

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC277907

Ingredient ID: NPC268647

Ingredient ID: NPC268564

Ingredient ID: NPC259512

Ingredient ID: NPC251666

Ingredient ID: NPC248726

Ingredient ID: NPC246165

Ingredient ID: NPC240702

Ingredient ID: NPC239039

Ingredient ID: NPC238475

Ingredient ID: NPC236602

Ingredient ID: NPC232247

Ingredient ID: NPC231738

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC22229

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC215632

Ingredient ID: NPC214909

Ingredient ID: NPC213749

Ingredient ID: NPC21266

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC198658

Ingredient ID: NPC196490

Ingredient ID: NPC194586

Ingredient ID: NPC19319

Ingredient ID: NPC193180

Ingredient ID: NPC189853

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC184049

Ingredient ID: NPC180684

Ingredient ID: NPC177112

Ingredient ID: NPC173996

Ingredient ID: NPC170799

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC161316

Ingredient ID: NPC155182

Ingredient ID: NPC154466

Ingredient ID: NPC14682

Ingredient ID: NPC14594

Ingredient ID: NPC14576

Ingredient ID: NPC14426

Ingredient ID: NPC143639

Ingredient ID: NPC141777

Ingredient ID: NPC141699

Ingredient ID: NPC13991

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC136534

Ingredient ID: NPC135238

Ingredient ID: NPC134590

Ingredient ID: NPC134114

Ingredient ID: NPC134107

Ingredient ID: NPC131981

Ingredient ID: NPC128027

Ingredient ID: NPC126240

Ingredient ID: NPC124876

Ingredient ID: NPC120926

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC107540

Ingredient ID: NPC100879