CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Ipomopsis Polycladon

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCCGCGAACTTGTAATCAAAATCGGGTGGCAGGGGGTGTGGTCCTATGGTCCTCCTCTTTTGCCCCCTAGCTGATAGTGCACTCACGGCCTATGGCAATGTGTGCACTTCGGCAAATTAACGAACCCCGGCGCAGTGTGCGCCAAGGAATTGTAACAAAGAGAGCTTGTTTGGAAGCCCCGTTCGCGGGTGCAGAAGAGCAATGCAATCTTACAAAAAACTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCTCACATCGCGTCGCCCCCACCCTATTTCCCTTGGGAATGATGGCGTTGGGAGCGGAAATTGGTCTCCCGTGCACTCTGATGTGCGGTTGGCCTAAATAAGAGTCGACGTGGACGAGCGTCACAACAAGTGGTGGTTGTCAAACCGTTGCGAAGTTGTTGTGCGTCATTGTCCTCAACGTGAACTCCAATGACCCTGTTGCATTGTGCAAGCAATGCCTCGACC

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCCCCCACCCTATTTCCCTTGGGAATGATGGCGTTGGGAGCGGAAATTGGTCTCCCGTGCACTCTGATGTGCGGTTGGCCTAAATAAGAGTCGACGTGGACGAGCGTCACAACAAGTGGTGGTTGTCAAACCGTTGCGAAGTTGTTGTGCGTCATTGTCCTCAACGTGAACTCCAATGACCCTGTTGCATTGTGCAAGCAATGCCTCGACC

Taxonomic Information

Plant ID: NPO17238
Plant Latin Name: Ipomopsis Polycladon
Taxonomy Genus: Ipomopsis
Taxonomy Family: Polemoniaceae

Plant External Links:

NCBI TaxonomyDB: 40743
Plant-of-the-World-Online: 129852-2

Used in Medicines

Unknown.

Geographical Distribution

United States; Mexico

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

8 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

2 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC78263

Ingredient ID: NPC76315

Ingredient ID: NPC235260

Ingredient ID: NPC179950

Ingredient ID: NPC150546

Ingredient ID: NPC141921

Ingredient ID: NPC133671

Ingredient ID: NPC113836

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	7

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04622865	Masitinib Combined With Isoquercetin and Best Supportive Care in Hospitalized Patients With Moderate and Severe COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT04474626	Isoquercetin in Sickle Cell Anemia	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT04514510	Fixed Dose Flavonoid Isoquercetin on Thrombo-Inflammatory Biomarkers in Subjects With Stable Sickle Cell Disease	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT02446795	Isoquercetin as an Adjunct Therapy in Patients With Kidney Cancer Receiving First-line Sunitinib: a Phase I/II Trial	renal cell carcinoma	Isoquercetin (NPC179950)	NP level
NCT04733651	Study to Investigate the Clinical Efficacy of Isoquercetin in Patients With COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT04536090	Study of Isoquercetin (IQC-950AN) Plus Standard of Care Versus Standard of Care Only for the Treatment of COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT02552888	Nitrite, Isoquercetin and Endothelial Dysfunction (NICE) Trial	chronic kidney disease	Isoquercetin (NPC179950)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA2,CA12,KDM1A,CA4
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12,CA2,CA4
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA2,CA4,CA12
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12,CA4,CA2
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04622865,NCT04733651,NCT04536090
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	KDM1A,CA2,CA7
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA4,CA12
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CA4,CA7
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA4,CA2
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT04514510,NCT04474626
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CA2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA2,CA4
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,CA4
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA12,KDM1A
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CA7
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA2,CA7
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,CA7
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA2,CA4
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,CA7
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CA7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CA2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CA2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,CA4
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDM1A
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	KDM1A
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2
Ewing sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B52	KDM1A
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDM1A
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	KDM1A
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KDM1A
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	KDM1A
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	NCT02446795
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	NCT02552888
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA4
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA4
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA2
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Ipomopsis Polycladon

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

8 All known Ingredients in Total

2 Ingredients with Acceptable Bioavailablity

5 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Solid tumour/cancer

Bacterial infection

Breast cancer

Seborrhoeic dermatitis

COVID-19

Carcinosarcoma of uterus

Hepatocellular carcinoma of liver

Malignant neoplasms of adrenal gland

Glaucoma

Sickle-cell disorder

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Hepatoblastoma

Diffuse large B-cell lymphomas

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Mesothelioma of pleura

Superficial ovarian endometriosis

Malignant neoplasms of thyroid gland, unspecified

Adenocarcinoma of bronchus or lung

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Germ cell tumour of testis

Low bone mass disorder

Myelodysplastic syndrome

Essential hypertension

Mature T-cell lymphoma

Rheumatoid arthritis

Ewing sarcoma

Duodenal ulcer

Heart failure

Lung cancer

Insomnia

Malignant haematopoietic neoplasm

Myeloproliferative neoplasm

Asthma

Acute myeloid leukaemia

Renal cell carcinoma

Chronic kidney disease

Osteoarthritis, unspecified

Malignant neoplasms of biliary tract, distal bile duct

Atrial fibrillation

Keratoconus

Pre-eclampsia

Tetralogy of Fallot

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Malignant neoplasms of corpus uteri, unspecified

Invasive carcinoma of breast

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities