• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hesperis Matronalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACCGTCGTCCCCCTCATCCTCTACGGATACGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCGAAATCCGAGCTCAGGACGCCTGGAGCGTCTCGGCATGCGGTGGCGAACACAAACCTCGTCCTACGGCCGGCCGCTCCTGTCCGAAAGCTCCTTACGACCCACAGAGTCATCAAC
Taxonomic Information

Plant ID: NPO17222
Plant Latin Name: Hesperis Matronalis
Taxonomy Genus: Hesperis
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 264418
Plant-of-the-World-Online: 285087-1

Used in Medicines

Unknown.

Geographical Distribution

Turkey; Italy; France; Ireland; Norway; Belarus; Germany; Belgium; Kazakhstan; Spain; Ukraine; Denmark; Poland; Finland; United States; Sweden; Switzerland; New Zealand; Russia; Albania; United Kingdom; Austria; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

46 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


19 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

21 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC86419

Ingredient ID: NPC85040

Ingredient ID: NPC62290

Ingredient ID: NPC50898

Ingredient ID: NPC49362

Ingredient ID: NPC3862

Ingredient ID: NPC34381

Ingredient ID: NPC32441

Ingredient ID: NPC311532

Ingredient ID: NPC309779

Ingredient ID: NPC29765

Ingredient ID: NPC297184

Ingredient ID: NPC285369

Ingredient ID: NPC279121

Ingredient ID: NPC270620

Ingredient ID: NPC266274

Ingredient ID: NPC262094

Ingredient ID: NPC262027

Ingredient ID: NPC260115

Ingredient ID: NPC257756

Ingredient ID: NPC25669

Ingredient ID: NPC24923

Ingredient ID: NPC246162

Ingredient ID: NPC238122

Ingredient ID: NPC234510

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC21608

Ingredient ID: NPC20791

Ingredient ID: NPC203100

Ingredient ID: NPC199727

Ingredient ID: NPC192158

Ingredient ID: NPC187432

Ingredient ID: NPC177234

Ingredient ID: NPC176740

Ingredient ID: NPC172262

Ingredient ID: NPC169073

Ingredient ID: NPC164599

Ingredient ID: NPC156654

Ingredient ID: NPC143799

Ingredient ID: NPC143005

Ingredient ID: NPC132778

Ingredient ID: NPC126029

Ingredient ID: NPC125062

Ingredient ID: NPC122110

Ingredient ID: NPC111888