• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ipomoea Nil


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AACCTGCGGAAGGATCATTGTCGAAACCTGTCACAGCAGAACGACCGGAGAACACGTTTGTTATTCACTATCGTCGTCCGGAGACTCGTCTCGGGCGATCAACCAACCCCCGGCGCGGAACGCGCCAAGGAATACCGCATCGAGATGGCCGGCCGCCCTTGCACCGTTATCGCGGATCGCTCGGGCGGCGTCGGCGTCTTACTTAACAAAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTGCTCGGCCCCTCGGCCGAGCTTGGGGAGCGGATGGTGGCCTCCCGTGCTCCCCTAACTCGGGGCGTGGCTGGCTCAAATGCGAGTCCCTGGCGGCGGACGTCACGGCGAGTGGTGGTCGTACCCAGCGTGCATATCTCCGCGCCGTGCCCCCGTCGTCCGCGGGCGAAAGACCCTTCGACGAGCCGCGTCAGTGCGGCTCTCCGACCGCGACCCCAGGTCAGGCGGGGATTACCCCGCTGAG

Click for details-----ITS1

TCGAAACCTGTCACAGCAGAACGACCGGAGAACACGTTTGTTATTCACTATCGTCGTCCGGAGACTCGTCTCGGGCGATCAACCAACCCCCGGCGCGGAACGCGCCAAGGAATACCGCATCGAGATGGCCGGCCGCCCTTGCACCGTTATCGCGGGTCGCTCGGGCGGCGTCGGCGTCTTACTTAACAAAATA

Click for details-----ITS2

ATCGCGTCGCCCCCCTGCTCGGCCCCTCGGCCGAGCTTGGGGAGCGGATGGTGGCCTCCCGTGCTCCCCTAACTCGGGGCGCGGCTGGCTCAAATGCGAGTCCCTGGCGGCGGACGTCACGGCGAATGGTGGTCGTACCCAGCGTGCATATCTCCGCGTCGTGCCCCCGTCGTCCGCGGGCGAAAGACCCTTCGACGAGCCGCGTCAGTGCGGCTCTCCGACCGC
Taxonomic Information

Plant ID: NPO17039
Plant Latin Name: Ipomoea Nil
Taxonomy Genus: Ipomoea
Taxonomy Family: Convolvulaceae

Plant External Links:

NCBI TaxonomyDB: 35883
Plant-of-the-World-Online: 1071575-2

Used in Medicines

Country/Region:
India; Laos

Traditional Medicine System:
Indian Folk; Unani; Ayurveda; Siddha


Medicinal Functions:

Anthelmintic; Antifungal; Antispasmodic; Antitumor; Diuretic; Hallucinogenic; Laxative; Parasiticide

Geographical Distribution

Brazil; Madagascar; Bangladesh; Sudan; Guinea; Nepal; Costa Rica; Bahamas; Ethiopia; Tanzania; Peru; Laos; Argentina; Bolivia; Cameroon; Cote d'Ivoire; Ecuador; Ghana; Saudi Arabia; Australia; Cuba; Venezuela; Zambia; Suriname; Guatemala; Zimbabwe; China; Vietnam; Thailand; Dominican Republic; Belize; United States; Sierra Leone; Nigeria; Eritrea; Netherlands; Uganda; Pakistan; Trinidad and Tobago; Philippines; Indonesia; New Caledonia; Mauritius; Sri Lanka; Uruguay; French Guiana; Guyana; Yemen; Haiti; Jamaica; Seychelles; Myanmar; Chad; Equatorial Guinea; Mexico; India; South Africa; Senegal; Congo; Colombia; Greece; Paraguay; Namibia; Nicaragua; Comoros

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

96 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


77 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

50 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9848

Ingredient ID: NPC95381

Ingredient ID: NPC91589

Ingredient ID: NPC9117

Ingredient ID: NPC8452

Ingredient ID: NPC81010

Ingredient ID: NPC79056

Ingredient ID: NPC76548

Ingredient ID: NPC70744

Ingredient ID: NPC66004

Ingredient ID: NPC65326

Ingredient ID: NPC64848

Ingredient ID: NPC60814

Ingredient ID: NPC5459

Ingredient ID: NPC51700

Ingredient ID: NPC50526

Ingredient ID: NPC479107

Ingredient ID: NPC479106

Ingredient ID: NPC479105

Ingredient ID: NPC479104

Ingredient ID: NPC479102

Ingredient ID: NPC479101

Ingredient ID: NPC479100

Ingredient ID: NPC479099

Ingredient ID: NPC479098

Ingredient ID: NPC47654

Ingredient ID: NPC40432

Ingredient ID: NPC37696

Ingredient ID: NPC37423

Ingredient ID: NPC35961

Ingredient ID: NPC34770

Ingredient ID: NPC34103

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC312017

Ingredient ID: NPC309320

Ingredient ID: NPC305205

Ingredient ID: NPC300017

Ingredient ID: NPC299151

Ingredient ID: NPC298180

Ingredient ID: NPC294902

Ingredient ID: NPC293399

Ingredient ID: NPC292510

Ingredient ID: NPC289774

Ingredient ID: NPC288537

Ingredient ID: NPC286946

Ingredient ID: NPC278102

Ingredient ID: NPC278021

Ingredient ID: NPC273858

Ingredient ID: NPC272392

Ingredient ID: NPC270070

Ingredient ID: NPC265932

Ingredient ID: NPC264711

Ingredient ID: NPC261012

Ingredient ID: NPC247553

Ingredient ID: NPC244669

Ingredient ID: NPC243728

Ingredient ID: NPC24284

Ingredient ID: NPC233335

Ingredient ID: NPC232028

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC225710

Ingredient ID: NPC224420

Ingredient ID: NPC222125

Ingredient ID: NPC216827

Ingredient ID: NPC216630

Ingredient ID: NPC210434

Ingredient ID: NPC207294

Ingredient ID: NPC205217

Ingredient ID: NPC203198

Ingredient ID: NPC201562

Ingredient ID: NPC19757

Ingredient ID: NPC195749

Ingredient ID: NPC192638

Ingredient ID: NPC192436

Ingredient ID: NPC185632

Ingredient ID: NPC177393

Ingredient ID: NPC169119

Ingredient ID: NPC165159

Ingredient ID: NPC164609

Ingredient ID: NPC164574

Ingredient ID: NPC161557

Ingredient ID: NPC158175

Ingredient ID: NPC158079

Ingredient ID: NPC153572

Ingredient ID: NPC152101

Ingredient ID: NPC151907

Ingredient ID: NPC143168

Ingredient ID: NPC142415

Ingredient ID: NPC141765

Ingredient ID: NPC134451

Ingredient ID: NPC121867

Ingredient ID: NPC115207

Ingredient ID: NPC113927

Ingredient ID: NPC1075