• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aesculus Turbinata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCGGCAGAACGACCCGCGAACTCTGTTTCATCACCGGGGGGATCGCTCGCGGTTCCCCTTGCGCCGCGGGGTCAAGGGCGCCTGCGCTTGCTCCGGCGGCGGCATAACACCGAACCCCGGCGCGGACCGCGTCAAGGAATTTTAACACGGGAGCATGCCCCTGCCGCCCCGGAAACGGTGTGCGTGCTTGCGGCGGTGCCCTTCTTCCATTATTTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGAGCCCCAAACCAATCGGCCGAGGGCACGTCTGCTTGGGTGTCACGCATCGTTGCCCCCGAACCCCTCCTCCTCGCGTCGTACGCGGGGCGGGGGGTCCCGTCGCGGGCGGAGACTGGCCTCCCGTGGGCCTCGGCCCGCGGTTGGCCCAAATACGAGTCCTCGGCGGTGTATGCCGCGGCGTTCGGTGGCGGAAAAAACCTCGAGCCCTCGCCGCGCGCACGCCGTCGGTCCAAGGCTCTCTGACCCTGAAGTGCCGTCGAAAACGCACGCATCGCGACCCCAGTC

Click for details-----ITS1

TCGAAACCTGCCCGGCAGAACGACCCGCGAACTCTGTTTCATCACCGGGGGGATCGCTCGCGGTTCCCCTTGCGCCGCGGGGTCAAGGGCGCCTGCGCTTGCTCCGGCGGCGGCATAACACCGAACCCCGGCGCGGACCGCGTCAAGGAATTTTAACACGGGAGCATGCCCCTGCCGCCCCGGAAACGGTGTGCGTGCTTGCGGCGGTGCCCTTCTTCCATTATTTAAAA

Click for details-----ITS2

ATCGTTGCCCCCGAACCCATCCTCCACGCGTCGTACGCGGGGCGGGGGGTCCCGTCGCGGGCGGAGATTGGCCTCCCGTGGGCCTCGGCCCGCGGTTGGCCCAAATACGAGTCCTCGGCGGTGTATGCCGCGGTGTTCGGTGGCGGAAAAAACCTCGAGCCCTCGCCGCGCGCGCGCCGTCGGTCCAAGGCTCTCTGACCCTGAAGTGCGGTTGAAAACGCACGCATCGCGACCTCAGTC
Taxonomic Information

Plant ID: NPO16900
Plant Latin Name: Aesculus Turbinata
Taxonomy Genus: Aesculus
Taxonomy Family: Hippocastanaceae

Plant External Links:

NCBI TaxonomyDB: 83375
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

39 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


25 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC95162

Ingredient ID: NPC88278

Ingredient ID: NPC85482

Ingredient ID: NPC8198

Ingredient ID: NPC79056

Ingredient ID: NPC75532

Ingredient ID: NPC74881

Ingredient ID: NPC69699

Ingredient ID: NPC56671

Ingredient ID: NPC325456

Ingredient ID: NPC324805

Ingredient ID: NPC324403

Ingredient ID: NPC321292

Ingredient ID: NPC308326

Ingredient ID: NPC294166

Ingredient ID: NPC293908

Ingredient ID: NPC275394

Ingredient ID: NPC27532

Ingredient ID: NPC26974

Ingredient ID: NPC253402

Ingredient ID: NPC241838

Ingredient ID: NPC227566

Ingredient ID: NPC224651

Ingredient ID: NPC21656

Ingredient ID: NPC209296

Ingredient ID: NPC205727

Ingredient ID: NPC195128

Ingredient ID: NPC1940

Ingredient ID: NPC182541

Ingredient ID: NPC172763

Ingredient ID: NPC159168

Ingredient ID: NPC1591

Ingredient ID: NPC154165

Ingredient ID: NPC140364

Ingredient ID: NPC137949

Ingredient ID: NPC136014

Ingredient ID: NPC125732

Ingredient ID: NPC120426

Ingredient ID: NPC107135

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Therapeutic Target Lyase CA9 Carbonic anhydrase IX Q16790 CHEMBL3594
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Oxidoreductase MAOA Monoamine oxidase A P21397 CHEMBL1951
Therapeutic Target Phosphodiesterase TDP1 Tyrosyl-DNA phosphodiesterase 1 Q9NUW8 CHEMBL1075138
Therapeutic Target Small molecule receptor (family A GPCR) CHRM1 Muscarinic acetylcholine receptor M1 P11229 CHEMBL216
Therapeutic Target Small molecule receptor (family A GPCR) CHRM2 Muscarinic acetylcholine receptor M2 P08172 CHEMBL211
Therapeutic Target Small molecule receptor (family A GPCR) CHRM5 Muscarinic acetylcholine receptor M5 P08912 CHEMBL2035
Therapeutic Target Small molecule receptor (family A GPCR) CHRM3 Muscarinic acetylcholine receptor M3 P20309 CHEMBL245
Therapeutic Target Small molecule receptor (family A GPCR) TAAR1 Trace amine-associated receptor 1 Q96RJ0 CHEMBL5857
Therapeutic Target Small molecule receptor (family A GPCR) CHRM4 Muscarinic acetylcholine receptor M4 P08173 CHEMBL1821
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level35
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT00783705 Inositol in Preventing Lung Cancer in Current or Former Smokers With Bronchial Dysplasia non-small cell lung carcinoma Inositol (NPC88278) NP level
NCT02647983 Multiparametric MRI for Prostate Cancer Localization and Characterization Using Hyperpolarized Pyruvate (13C) Injection prostate adenocarcinoma Pyruvate (NPC286233) NP level
NCT00264186 Recombinant Human Superoxide Dismutase (rhSOD) and Vascular Reactivity inflammation Acetylcholine (NPC1591) NP level
NCT04204044 Comparison of Myoinositol and Metformin in PCO polycystic ovary syndrome Inositol (NPC88278) NP level
NCT00330096 Effects of Hesperidin on Bone Mineral Density and Bone Metabolism of Postmenopausal Women osteoporosis Hesperidin (NPC79056) NP level
NCT02616731 Oral Tranexamic Acid Versus Diosmin for Treatment of Menorrhagia in Women Using Copper IUD Menorrhagia Diosmin (NPC209296) NP level
NCT02134249 Diosmin Versus Cabergoline for Prevention of Ovarian Hyperstimulation Syndrome infertility Diosmin (NPC209296) NP level
NCT05219799 Sex Disparities in Hypoxic Vasodilation and Impact of Obesity obesity Acetylcholine (NPC1591) NP level
NCT02634801 A Study of Ixekizumab (LY2439821) in Participants With Moderate-to-Severe Plaque Psoriasis Naive to Systemic Treatment psoriasis Fumaric Acid (NPC224651) NP level
NCT01046500 Myo-inositol Versus Metformin Administration in Post-menopausal Women With Metabolic Syndrome metabolic syndrome Inositol (NPC88278) NP level
NCT00452829 Prevention of Neural Tube Defects by Inositol in Conjunction With Folic Acid (PONTI Study) neural tube defect Inositol (NPC88278) NP level
NCT00009581 Nitric Oxide to Improve Blood Flow in Sickle Cell Disease sickle cell anemia Acetylcholine (NPC1591) NP level
NCT00250185 The Role of Nitrite in Preconditioning Mediated Tolerance to Ischemic Stress ischemia Acetylcholine (NPC1591) NP level
NCT00061997 Inositol in Preventing Lung Cancer in Patients With Bronchial Epithelial Dysplasia Who Are Current or Former Smokers lung cancer Inositol (NPC88278) NP level
NCT01574261 Could the Therapy With Inositol Affect the Cardiovascular Risk in PCOS Women? Results of a Randomized Clinical Trial polycystic ovary syndrome Inositol (NPC88278) NP level
NCT02474082 Study of Secukinumab Compared to Fumaderm® in Adults With Moderate to Severe Psoriasis. psoriasis Fumaric Acid (NPC224651) NP level
NCT03446612 Anemia Study in Chronic Kidney Disease (CKD) : Erythropoiesis Via a Novel Prolyl Hydroxylase Inhibitor (PHI) Daprodustat -Forearm Blood Flow (ASCEND-FBF) anemia (phenotype) Acetylcholine (NPC1591) NP level
NCT02951533 A Study to Compare the Efficacy of Guselkumab to Fumaric Acid Esters for the Treatment of Participants With Moderate to Severe Plaque Psoriasis psoriasis Fumaric Acid (NPC224651) NP level
NCT00748059 The Pathophysiology of Orthostatic Hypotension orthostatic hypotension;orthostatic intolerance Tyramine (NPC125732) NP level
NCT01115127 Myo-inositol and Melatonin in Pre-menopausal Women hemorrhage Inositol (NPC88278) NP level
NCT01954082 Inositol to Reduce Retinopathy of Prematurity retinopathy of prematurity Inositol (NPC88278) NP level
NCT00203125 A Study to Evaluate the Effects of Tyramine in Patients Who Completed the PRESTO Study. Parkinson disease Tyramine (NPC125732) NP level
NCT01110512 Comparative Efficacy of Two Preparations of the Association Diosmin (450 mg) + Hesperidin (50 mg) in the Treatment of Chronic Venous Insufficiency (CVI) venous insufficiency Diosmin (NPC209296) NP level
NCT00072826 Atorvastatin Therapy to Improve Endothelial Function in Sickle Cell Disease sickle cell anemia Acetylcholine (NPC1591) NP level
NCT03121989 Study to Evaluate the Feasibility of 13-C Pyruvate Imaging in Breast Cancer Patients Receiving Neoadjuvant Chemotherapy breast cancer Pyruvate (NPC286233) NP level
NCT03462017 Pharmacodynamic Study to Assess the Effects of Repeated Dosing of SAR247799 on Endothelial Function in Patients With Type 2 Diabetes Mellitus coronary artery disease Acetylcholine (NPC1591) NP level
NCT00001870 Study of the Effects of Vitamin C on Patients With Type 2 Diabetes type 2 diabetes mellitus Acetylcholine (NPC1591) NP level
NCT00508989 Niacin to Improve Blood Flow in People With Sickle Cell Disease sickle cell anemia Acetylcholine (NPC1591) NP level
NCT02730949 D-chiro-Inositol in Overweight Type 1 Diabetes Patients type 1 diabetes mellitus Inositol (NPC88278) NP level
NCT01321164 Fumaric Acid Versus Fumaric Acid Plus Narrow Band Type B Ultraviolet (UVB) for Psoriasis psoriasis Fumaric Acid (NPC224651) NP level
NCT01352988 Efficacy and Safety of Fumaric Acid Esters (Fumaderm®) in the Treatment of Patients With Cutaneous Lupus Erythematosus cutaneous lupus erythematosus Fumaric Acid (NPC224651) NP level
NCT00327080 Sildenafil to Treat HIV-Associated Pulmonary Hypertension HIV infection Acetylcholine (NPC1591) NP level
NCT00934050 ELND005 Long-Term Follow-up Study in Subjects With Alzheimer's Disease Alzheimer disease Inositol (NPC88278) NP level
NCT00453531 Model System for Transient Forearm Blood Vessel Dysfunction ischemia Acetylcholine (NPC1591) NP level
NCT01875445 Inositol in Trichotillomania Hair-pulling Inositol (NPC88278) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 CHRM5,CHRFAM7A,CHRM1,TAAR1,CHRNA7,MAOA
 NCT00203125
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 CHRM2,CHRNA7,CHRM5,CHRM3,CHRM4,CHRFAM7A
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 MAOA,CHRNA7,CHRM1,CHRNA4,CHRFAM7A
 NCT00934050
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CHRM4,TDP1,CA9,HSD17B10,CHRNA4,CHRM1
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CHRM4,TDP1,CYP1A2,CA9,CA12,CHRM1
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CHRM4,CHRNA7,CHRM5,CYP1A1,CHRNA4,CHRM1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CHRM3,CHRM2,CHRNA7,CA9,CA12,CHRNA4
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA12,CA9,CHRFAM7A,CHRNA7
 NCT03121989
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CHRM1,CHRM2,CHRM5,CHRM3,CHRM4
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 CHRFAM7A,CHRNA7,MAOA,TAAR1,CHRNA4
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 CHRM4,CHRM2,CHRNA7,CHRM1,CHRM3
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA9,CA12,CHRM3,CA12,CA9
Corneal disease
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A76-9A78
 CHRNA4,CHRFAM7A,CHRM1,CHRNA7
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CA9,CA12,CHRM5,CHRM1
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 CHRM1,CHRFAM7A,CHRNA7,TAAR1
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 MAOA,CHRFAM7A,CHRM1,CHRNA7
Peptic ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA61
 CHRM1,CHRM3,CHRM2,CHRM5
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 NCT01321164,NCT02474082,NCT02951533,NCT02634801
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 TDP1,CA9,HSD17B10,CA12
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CHRM4,TDP1,CA9,CA12
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A2,CYP1A1,CA12,CHRM1
Respiratory system disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB40-CB7Z
 CHRM2,CHRM3,CHRM4
Nicotine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C4A
 CHRNA4,CHRNA7,CHRFAM7A
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 CHRM1,CHRNA4,CHRM5
Functional bladder disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GC50
 CHRM1,CHRM3,CHRM5
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 CHRFAM7A,CHRM1,CHRNA7
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 CHRM1,CHRM5,CHRM3
Abnormal micturition
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MF50
 CHRM2,CHRM5,CHRM1
Sebaceous gland disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED91
 CHRM3,CHRM1,CHRM2
Sickle-cell disorder
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A51
 NCT00009581,NCT00508989,NCT00072826
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CHRNA7,CA12,CHRM3
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CHRNA7,CA9,CA12
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CYP1B1,CHRM4,CA9
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP1B1,CA9,HSD17B10
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA9,CA12,CHRNA4
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CYP1B1,CA9,CA12
Adaptive immunity immunodeficiency
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A01
 CHRNA7,CHRFAM7A
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 CHRM1
 NCT05219799
Nausea/vomiting
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD90
 CHRM3,CHRM4
Tonus and reflex abnormality
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB47
 CHRM5,CHRM3
Mood disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60-6E23
 CHRNA4,MAOA
Sexual dysfunction
Disease Category: 17.Conditions related to sexual health
Disease ICD-11 Code: HA00-HA01
 CHRFAM7A,CHRNA7
Sex development malformative disorder
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2A
 CHRFAM7A,CHRNA7
Dissociative neurological symptom disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B60
 CHRFAM7A,CHRNA7
Attention deficit hyperactivity disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A05
 TAAR1,CHRNA4
Mental/behavioural/neurodevelopmental disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6E20-6E8Z
 CHRFAM7A,CHRNA7
Digestive system disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DE2Z
 CHRM5,CHRNA4
NA
Disease Category: NA
Disease ICD-11 Code: NA
 NCT00748059,NCT00264186
Ischemia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B10-8B11
 NCT00250185,NCT00453531
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 NCT01574261,NCT04204044
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CHRNA7,CA9
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 CHRM5,CA9
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CA9,CA9
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CA9,CYP1A1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,CA9
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP1A2,CA9
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CA9,CYP1A1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 CHRM5,CYP1A1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CYP1B1,CA12
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA9,CA12
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CA9,CYP1A1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 CHRM4,CHRNA4
Nystagmus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C84
 CHRM5
Brain disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70-8E61
 CHRM5
Infectious gastroenteritis/colitis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A40
 CHRM5
Dyslipidemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80-5C81
 CHRM1
Eye anterior segment structural developmental anomaly
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA11
 CHRM4
Central and peripheral nervous disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A04-8E7Z
 CHRM5
Muscle disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB32-FB3Z
 CHRM2
Hypertensive crisis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA03
 CHRNA4
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 CHRM5
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 MAOA
Appearance/behaviour symptom
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB23
 CHRM5
General examination
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QA00
 CHRM5
Hyperhidrosis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EE00
 CHRM1
Cognition symptoms/signs/clinical sympton
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB21
 CHRM5
Urgency
Disease Category: NA
Disease ICD-11 Code: N.A.
 CHRM5
Sjogren syndrome
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A43
 CHRM3
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 CHRM5
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 MAOA
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 MAOA
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 CA9
Polyuria
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MF55
 CHRM5
Gastric ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA60
 CHRM1
Intellectual development disorder
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD90
 CHRM1
Skin tag/polyp
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK71
 MAOA
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 CA9
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 CHRM1
Schizoaffective disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A21
 CHRM1
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 CHRM5
Cough
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD12
 CHRM5
Narcolepsy
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A20
 TAAR1
Focal/segmental autonomic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D8A
 TAAR1
Anterior uveitis
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A96
 CHRM5
Dystonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A02
 CHRM1
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CHRM1
Abdominal pelvic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD81
 CHRM1
Epileptic encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A62
 CHRM1
Pancreatitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DC31-DC34
 CHRM5
Oesophagus motility disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA21
 CHRM5
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 CHRM5
Gastritis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA42
 CHRM5
Aneurysm/dissection
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD50
 CHRNA4
Hypotension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA20-BA21
 CHRNA4
Heavy menstrual bleeding
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20.50
 NCT02616731
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 NCT01046500
Trichotillomania
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B25.0
 NCT01875445
Male infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB04
 NCT02134249
Osteoporosis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83.1
 NCT00330096
Spina bifida, unspecified
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA02.Z
 NCT00452829
Chronic lower extremities peripheral venous insufficiency
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD74
 NCT01110512
Orthostatic hypotension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA21
 NCT00748059
Anemia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A00-3A9Z
 NCT03446612
Cutaneous lupus erythematosus
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EB50-EB5Z
 NCT01352988
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 NCT00783705
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT03462017
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NCT00001870
Retinopathy of prematurity
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71.3
 NCT01954082
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NCT02647983
Type1diabetesmellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A10
 NCT02730949
Haemorrhage, not elsewhere classified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG27
 NCT01115127
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 NCT00061997
Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62.Z
 NCT00327080
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 CHRM4
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Hypertrophic cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43.1
 CHRM3
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 MAOA
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 CHRNA4
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 CHRNA7
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA12
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group