• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aconitum Episcopale


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGCGTCGCACCCCGTCAACCACGTTGTCGGGGAGCGAAGATTGGCCCCCCGGGCCCCTGCGGGCACGGTCGGCAGAAATGTTTGTCCCCGGCGGCGAGCGTCGCGGTCAGTGGTGGTTGTATCTCTCATCCTCCAAAGACATCAAGACGCGTCGTCCTCGTTGCATGTTGGGACACATCGACCCCACGGAGCCGCTTCGCGCGGCATTCACCCT
Taxonomic Information

Plant ID: NPO16877
Plant Latin Name: Aconitum Episcopale
Taxonomy Genus: Aconitum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 226106
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

41 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


38 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC90105

Ingredient ID: NPC89422

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC76145

Ingredient ID: NPC7343

Ingredient ID: NPC71853

Ingredient ID: NPC54542

Ingredient ID: NPC52464

Ingredient ID: NPC50623

Ingredient ID: NPC3649

Ingredient ID: NPC326895

Ingredient ID: NPC31279

Ingredient ID: NPC302939

Ingredient ID: NPC292792

Ingredient ID: NPC287660

Ingredient ID: NPC276863

Ingredient ID: NPC27184

Ingredient ID: NPC255566

Ingredient ID: NPC241784

Ingredient ID: NPC236536

Ingredient ID: NPC227894

Ingredient ID: NPC213749

Ingredient ID: NPC204120

Ingredient ID: NPC195986

Ingredient ID: NPC193666

Ingredient ID: NPC186903

Ingredient ID: NPC180466

Ingredient ID: NPC171928

Ingredient ID: NPC161557

Ingredient ID: NPC161405

Ingredient ID: NPC158840

Ingredient ID: NPC158526

Ingredient ID: NPC152618

Ingredient ID: NPC150723

Ingredient ID: NPC141777

Ingredient ID: NPC139778

Ingredient ID: NPC138113

Ingredient ID: NPC111544

Ingredient ID: NPC106840

Ingredient ID: NPC101374