• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eucommia Ulmoides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGCCTAAATCTTGACCGCGAACCCGTTTACAACCGACGGAGCGAGGGAGACGGTACTTGCGGGCGACCGCCGACCGATCCTCCCTCCCACGTCCCCAACAACAAACCCCGGCGCAGGTCGCGCCAAGGAAGTATATTATTACCGGGATGCCGGCGTCTTCCGTCGTGCTCCGTCCGCGGTCCGCACACGGGACGCCGGCGTCTTCCGAACGAACAAACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCAAAACCCTGCCCCACCAGTGGGGGGGTTGGGGGGAGCGGAGATTGGCCTCCCGTGCGCCCGGCGTGCGCGGCTGGCCGAAAACAGAGACGACGGCAACGGACGTCACGACTAGCGGTGGTCGTACGATAGCCAATGCATGAGTTTAAGCATCCGTGCCGTCTTCGACCCCCACGAGAGCCCCGAGCTCCATTGCGACC

Click for details-----ITS1

TCGAAGCCTAAATCTGACCGCGAACCCGTTTACAACCGACGGAGCGAGGGAGACGGACGGCGGGCGCACCGTCGACCGATCCTCCCTCCCACGTCCCCAACAACAAACCCCGGCGCAGGTCGCGCCAAGGAAGTATATTATTACCGGGATGCCGGCGTCTTCCGTCGTGCTCCGTCCGCGGTCCGCACACGGGACGCCGGCGTCTTCCGAACGAACAAACAA

Click for details-----ITS2

ATCGCGTCGCTCCCAAAACCCTGCCCCACCAGTGGGGGGGTTGGGGGGAGCGGAGATTGGCCTCCCGTGCGCCCGGCGTGCGCGGCTGGCCGAAAACAGAGACGACGGCAACGGACGTCACGACTAGCGGTGGTCGTACGATAGCCAATGCATGAGTTTAAGCATCCGTGCCGTCTTCGACCCCCACGAGAGCCCCGAGCTCCATTGCGACCCCAGGTCAGGCGGAACT
Taxonomic Information

Plant ID: NPO16850
Plant Latin Name: Eucommia Ulmoides
Taxonomy Genus: Eucommia
Taxonomy Family: Eucommiaceae

Plant External Links:

NCBI TaxonomyDB: 4392
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Analgesic; Anticholesterolemic; Aphrodisiac; Astringent; Depurative; Diuretic; Hepatic; Hypotensive; Sedative; Tonic; Vasodilator

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

212 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


114 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

107 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96507

Ingredient ID: NPC95615

Ingredient ID: NPC95575

Ingredient ID: NPC95392

Ingredient ID: NPC95381

Ingredient ID: NPC95292

Ingredient ID: NPC93201

Ingredient ID: NPC93190

Ingredient ID: NPC92774

Ingredient ID: NPC92638

Ingredient ID: NPC92507

Ingredient ID: NPC85813

Ingredient ID: NPC84398

Ingredient ID: NPC81775

Ingredient ID: NPC81559

Ingredient ID: NPC81010

Ingredient ID: NPC76365

Ingredient ID: NPC73143

Ingredient ID: NPC70744

Ingredient ID: NPC66577

Ingredient ID: NPC61477

Ingredient ID: NPC60348

Ingredient ID: NPC55158

Ingredient ID: NPC51700

Ingredient ID: NPC51328

Ingredient ID: NPC49074

Ingredient ID: NPC48803

Ingredient ID: NPC47481

Ingredient ID: NPC46855

Ingredient ID: NPC46616

Ingredient ID: NPC43169

Ingredient ID: NPC42999

Ingredient ID: NPC39522

Ingredient ID: NPC37859

Ingredient ID: NPC36408

Ingredient ID: NPC35741

Ingredient ID: NPC35185

Ingredient ID: NPC35071

Ingredient ID: NPC34902

Ingredient ID: NPC34125

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC326452

Ingredient ID: NPC323684

Ingredient ID: NPC323434

Ingredient ID: NPC322360

Ingredient ID: NPC322214

Ingredient ID: NPC319625

Ingredient ID: NPC318205

Ingredient ID: NPC316724

Ingredient ID: NPC314192

Ingredient ID: NPC311256

Ingredient ID: NPC310804

Ingredient ID: NPC308953

Ingredient ID: NPC307783

Ingredient ID: NPC307426

Ingredient ID: NPC306344

Ingredient ID: NPC304646

Ingredient ID: NPC302857

Ingredient ID: NPC301972

Ingredient ID: NPC301696

Ingredient ID: NPC299059

Ingredient ID: NPC298255

Ingredient ID: NPC29799

Ingredient ID: NPC295492

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC29430

Ingredient ID: NPC293183

Ingredient ID: NPC291789

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC28913

Ingredient ID: NPC288537

Ingredient ID: NPC28779

Ingredient ID: NPC283655

Ingredient ID: NPC280254

Ingredient ID: NPC279074

Ingredient ID: NPC278324

Ingredient ID: NPC278068

Ingredient ID: NPC277804

Ingredient ID: NPC276789

Ingredient ID: NPC276753

Ingredient ID: NPC275463

Ingredient ID: NPC274291

Ingredient ID: NPC270578

Ingredient ID: NPC26974

Ingredient ID: NPC268432

Ingredient ID: NPC268221

Ingredient ID: NPC2665

Ingredient ID: NPC264711

Ingredient ID: NPC264317

Ingredient ID: NPC261619

Ingredient ID: NPC261117

Ingredient ID: NPC259896

Ingredient ID: NPC258501

Ingredient ID: NPC257582

Ingredient ID: NPC257072

Ingredient ID: NPC255677

Ingredient ID: NPC252433

Ingredient ID: NPC252126

Ingredient ID: NPC250486

Ingredient ID: NPC249045

Ingredient ID: NPC247553

Ingredient ID: NPC247546

Ingredient ID: NPC24751

Ingredient ID: NPC244315

Ingredient ID: NPC243702

Ingredient ID: NPC241911

Ingredient ID: NPC241548

Ingredient ID: NPC241111

Ingredient ID: NPC239862

Ingredient ID: NPC23962

Ingredient ID: NPC239406

Ingredient ID: NPC239312

Ingredient ID: NPC236579

Ingredient ID: NPC23549

Ingredient ID: NPC234306

Ingredient ID: NPC23288

Ingredient ID: NPC231535

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC222660

Ingredient ID: NPC22150

Ingredient ID: NPC22149

Ingredient ID: NPC219876

Ingredient ID: NPC218503

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC21563

Ingredient ID: NPC214584

Ingredient ID: NPC214067

Ingredient ID: NPC213935

Ingredient ID: NPC21344

Ingredient ID: NPC212363

Ingredient ID: NPC211764

Ingredient ID: NPC211455

Ingredient ID: NPC209970

Ingredient ID: NPC209961

Ingredient ID: NPC20791

Ingredient ID: NPC205003

Ingredient ID: NPC204069

Ingredient ID: NPC201723

Ingredient ID: NPC201387

Ingredient ID: NPC200740

Ingredient ID: NPC195019

Ingredient ID: NPC194458

Ingredient ID: NPC192810

Ingredient ID: NPC192107

Ingredient ID: NPC192065

Ingredient ID: NPC19125

Ingredient ID: NPC188717

Ingredient ID: NPC187998

Ingredient ID: NPC185841

Ingredient ID: NPC183941

Ingredient ID: NPC18229

Ingredient ID: NPC181604

Ingredient ID: NPC180102

Ingredient ID: NPC179950

Ingredient ID: NPC179686

Ingredient ID: NPC178887

Ingredient ID: NPC1788

Ingredient ID: NPC178383

Ingredient ID: NPC177475

Ingredient ID: NPC177013

Ingredient ID: NPC176740

Ingredient ID: NPC174249

Ingredient ID: NPC173543

Ingredient ID: NPC170526

Ingredient ID: NPC167976

Ingredient ID: NPC167577

Ingredient ID: NPC16728

Ingredient ID: NPC167072

Ingredient ID: NPC16157

Ingredient ID: NPC158079

Ingredient ID: NPC156654

Ingredient ID: NPC155205

Ingredient ID: NPC154792

Ingredient ID: NPC154477

Ingredient ID: NPC148898

Ingredient ID: NPC142703

Ingredient ID: NPC141645

Ingredient ID: NPC141573

Ingredient ID: NPC141273

Ingredient ID: NPC14076

Ingredient ID: NPC139617

Ingredient ID: NPC138925

Ingredient ID: NPC137949

Ingredient ID: NPC136699

Ingredient ID: NPC133671

Ingredient ID: NPC131624

Ingredient ID: NPC130683

Ingredient ID: NPC127524

Ingredient ID: NPC126029

Ingredient ID: NPC125467

Ingredient ID: NPC123965

Ingredient ID: NPC122078

Ingredient ID: NPC119837

Ingredient ID: NPC118761

Ingredient ID: NPC117743

Ingredient ID: NPC116850

Ingredient ID: NPC116775

Ingredient ID: NPC11592

Ingredient ID: NPC113219

Ingredient ID: NPC112861

Ingredient ID: NPC111897

Ingredient ID: NPC110942

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC107334

Ingredient ID: NPC103465

Ingredient ID: NPC103213