• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Physalis Angulata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTCGAAACCTGCTAAGCAGAGCGACCCGCGAACCTGTTTGAACACCGGGGAGGCGCGCCTTGGCTCGCCTCCCCCTCGTCGTCCGGCGGTCGCGCGCGCGCGTTCGCCGGTCGACCAACGAACCCCGGCGCGGAACGCGCCAAGGAATACTGAACCGATGGCCTGGCCCTCGCGCCCCGTCCGCGGCGCGCGCGGGGGACCTGCGCTTCGCATGAAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCTCGCCCCGCTGAGCGCGGGGCGTGGCGGGACGGATGCTGGCCTCCCGTGCGCTCGCAGCGCGCGGCTGGCCTAAATGCGAGCCCGCGTCGACGGACGTCACGGCAAGTGGTGGTTGAATCTCAACTCTCTTGGTGCCGTGGCCGAACCCGTCGCGCGCGTCGGCTGCTAGACCCTTCCGGCGCTTAGGCGCTCCGACCGCGACCCCAGGTCAGGCGGGATT

Click for details-----ITS1

CGAAACCTGCTAGCAGAGCGACCCGCGAACCTGTTTGAACACCGGGGAGGCGCGCCTTGGCTCGCCTCCCCCTCGTGTCCGGCGGTCGCGCGCGCGCGTTTTCGGTCGACCAACGAACCCGGCGCGGAACGCGCCAAGGAATACTGATGCGATGGCCTCYCCTCGCCCCCGCTGGCGGCGCGCGGGGGAAGTGCGCTTCGCTGAAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTTCGCCCCGCTAGCGCGGGGCGTGGCGGGACGGATGCTGGCCTCCCGTGCGCTCTCAGCGGGCGGCTGGCCTAAATGCGAGCCCGCGTCGACGGACGTCACGGCAAGTGGTGGTTGAATCTCAACTCTCTTGGTGCCGTGGCCGAACCCGTCGCGCGCGTCGGCTGCTAGACCTTCC
Taxonomic Information

Plant ID: NPO1680
Plant Latin Name: Physalis Angulata
Taxonomy Genus: Physalis
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 113208
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Ghana; Indonesia; India; Kenya; Bolivia

Traditional Medicine System:


Medicinal Functions:

Diuretic; Expectorant; Febrifuge

Geographical Distribution

Brazil; Ghana; Indonesia; India; Kenya; Bolivia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

54 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


15 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

50 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC83438

Ingredient ID: NPC75844

Ingredient ID: NPC64449

Ingredient ID: NPC62608

Ingredient ID: NPC484714

Ingredient ID: NPC484713

Ingredient ID: NPC484712

Ingredient ID: NPC484711

Ingredient ID: NPC484710

Ingredient ID: NPC484709

Ingredient ID: NPC484708

Ingredient ID: NPC484707

Ingredient ID: NPC484706

Ingredient ID: NPC484705

Ingredient ID: NPC484704

Ingredient ID: NPC484703

Ingredient ID: NPC484702

Ingredient ID: NPC484701

Ingredient ID: NPC484700

Ingredient ID: NPC484699

Ingredient ID: NPC484698

Ingredient ID: NPC484697

Ingredient ID: NPC484695

Ingredient ID: NPC484694

Ingredient ID: NPC484693

Ingredient ID: NPC484692

Ingredient ID: NPC484691

Ingredient ID: NPC484690

Ingredient ID: NPC41988

Ingredient ID: NPC33378

Ingredient ID: NPC331672

Ingredient ID: NPC331613

Ingredient ID: NPC329671

Ingredient ID: NPC326856

Ingredient ID: NPC325599

Ingredient ID: NPC307753

Ingredient ID: NPC297292

Ingredient ID: NPC264192

Ingredient ID: NPC261333

Ingredient ID: NPC254146

Ingredient ID: NPC246093

Ingredient ID: NPC243014

Ingredient ID: NPC232533

Ingredient ID: NPC192237

Ingredient ID: NPC18509

Ingredient ID: NPC18074

Ingredient ID: NPC168799

Ingredient ID: NPC166213

Ingredient ID: NPC164523

Ingredient ID: NPC162313

Ingredient ID: NPC158319

Ingredient ID: NPC144739

Ingredient ID: NPC125159

Ingredient ID: NPC100390