• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Glinus Lotoides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCTGTGCACACGTTATCACAATCACAGGAGTGCACGGGGTCCCTAGTCGGCCCCCGGGCATTCCTAGCCTCTGGCACAATAACGAAAACCCGGCGTGAAAAGCGCCAAGGAACACGAACACATTGCGTGCTTGCCCGTACTCGGATCCTCCGGTGTGCGGGCTTGCGCCTCTCCTTTACTAATTTAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCTCGAGACTCCCCCATCCGACCTGGTGTGAGGAGGGGAAGGAGGATGGTCTCCCATTCCTCATCGGGGACGGCTGACCAAAAAGAGGAGCCCACGGTGAAGAGCTGCCGCGGCATTAGGTGGTTTGATGAAGCTTCGGCCGTCTCRAATTCTCGCCGTGTGCATGCACTTTGCCGAGGGACTCGGAGGACCCTAGCGAGCATCGCTCGTTACCGTTGCGACCCCA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO16799
Plant Latin Name: Glinus Lotoides
Taxonomy Genus: Glinus
Taxonomy Family: Molluginaceae

Plant External Links:

NCBI TaxonomyDB: 169249
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM; Ayurveda; Siddha

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

18 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC78263

Ingredient ID: NPC70463

Ingredient ID: NPC68402

Ingredient ID: NPC50712

Ingredient ID: NPC37250

Ingredient ID: NPC3685

Ingredient ID: NPC274305

Ingredient ID: NPC209970

Ingredient ID: NPC209560

Ingredient ID: NPC20791

Ingredient ID: NPC184649

Ingredient ID: NPC181465

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC159362

Ingredient ID: NPC133671

Ingredient ID: NPC12323

Ingredient ID: NPC116775