• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Codonopsis Pilosula


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTGAACAACACCGGGGACGCGGGCTTGCCCGTGGCCCCTTGCCGTCGGCGCACGCACCCGCCCAACCACTTGGTGGCAGGGAGTGTGCGTGCGTCGTTCGGCGCCAAACGAACCCCGGCGCGATCCGCGCCAAGGAAAACTTAACTCAAAGAGCGCCCCGTCCTCCCGTCGCCCCGTTCGCGGTGTGCGCACGGTTGGGCGGTCGCTTCTTAGTGAAAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCATGGGCGTCACGCATCGCGTCGCCTCCCTTAACTTAATTGTTTACAAAACAAGTCAAGGAAAGGGGGAGCGGATACTGGCCTCCCGTGCCTTGCGGCGCGGCTGGCTGAAAACGGAGTCCCCCGCGAAGGACGCACGACAAGTGGTGGTTGATAACAAGGCCCTCGCGTCCCGTCGTGCGCACGTCCTGCGATGGGTTGGCTCTCGTGACCCTGACGCGTCTAGGCTTAAGCCTAAGGCGCTCCGA

Click for details-----ITS1

TGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTGAACAACACCGGGGACGCGGGCTTGCCCGTGGCCCCTTGCCGTCGGCGCACGCACCCGCCCAACCACTTGGTGGAAGGGAGCATGTGTGCGTCGTTCGGCGCCAAACGAACCCCGGCGCGATCCGCGCCAAGGAAAACTTAACTCAAAGAGCGCCACGTCCTCCCGTCGCCCCGTTCGCGGTGTGCGCACGGTTGGGCGGTCGCTTCTTAGTGAAAAACATAAA

Click for details-----ITS2

ATCGCGTCGCCTCCCTTAACTTAATTGTTTACAAAACAAGTCAAGGAAAGGGGGAGCGGATACTGGCCTCCCGTGCCTTGCRGCGCGGCTGGCTCAAAACGGAGTCCCCCGCGAAGGACGCACGACAAGTGGTGGTTGATAACAAGGCCCTCGCGTCCCGTCGTGCGCACGTCCTACGATGGGTTGGCTCTCGTGACCCTGACGCGTCTAGGCTTAAGCCTAAGGCGCTCCGACCGCGACC
Taxonomic Information

Plant ID: NPO16741
Plant Latin Name: Codonopsis Pilosula
Taxonomy Genus: Codonopsis
Taxonomy Family: Campanulaceae

Plant External Links:

NCBI TaxonomyDB: 86864
Plant-of-the-World-Online: n.a.

Collective Molecular Activities of the Plant: Codonopsis Pilosula


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTGAACAACACCGGGGACGCGGGCTTGCCCGTGGCCCCTTGCCGTCGGCGCACGCACCCGCCCAACCACTTGGTGGCAGGGAGTGTGCGTGCGTCGTTCGGCGCCAAACGAACCCCGGCGCGATCCGCGCCAAGGAAAACTTAACTCAAAGAGCGCCCCGTCCTCCCGTCGCCCCGTTCGCGGTGTGCGCACGGTTGGGCGGTCGCTTCTTAGTGAAAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCATGGGCGTCACGCATCGCGTCGCCTCCCTTAACTTAATTGTTTACAAAACAAGTCAAGGAAAGGGGGAGCGGATACTGGCCTCCCGTGCCTTGCGGCGCGGCTGGCTGAAAACGGAGTCCCCCGCGAAGGACGCACGACAAGTGGTGGTTGATAACAAGGCCCTCGCGTCCCGTCGTGCGCACGTCCTGCGATGGGTTGGCTCTCGTGACCCTGACGCGTCTAGGCTTAAGCCTAAGGCGCTCCGA

Click for details-----ITS1

TGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTGAACAACACCGGGGACGCGGGCTTGCCCGTGGCCCCTTGCCGTCGGCGCACGCACCCGCCCAACCACTTGGTGGAAGGGAGCATGTGTGCGTCGTTCGGCGCCAAACGAACCCCGGCGCGATCCGCGCCAAGGAAAACTTAACTCAAAGAGCGCCACGTCCTCCCGTCGCCCCGTTCGCGGTGTGCGCACGGTTGGGCGGTCGCTTCTTAGTGAAAAACATAAA

Click for details-----ITS2

ATCGCGTCGCCTCCCTTAACTTAATTGTTTACAAAACAAGTCAAGGAAAGGGGGAGCGGATACTGGCCTCCCGTGCCTTGCRGCGCGGCTGGCTCAAAACGGAGTCCCCCGCGAAGGACGCACGACAAGTGGTGGTTGATAACAAGGCCCTCGCGTCCCGTCGTGCGCACGTCCTACGATGGGTTGGCTCTCGTGACCCTGACGCGTCTAGGCTTAAGCCTAAGGCGCTCCGACCGCGACC
Taxonomic Information

Plant ID: NPO16741
Plant Latin Name: Codonopsis Pilosula
Taxonomy Genus: Codonopsis
Taxonomy Family: Campanulaceae

Plant External Links:

NCBI TaxonomyDB: 86864
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; South Korea; China

Traditional Medicine System:
TCM

Geographical Distribution

Thailand; South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

237 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


152 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

90 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98858

Ingredient ID: NPC97444

Ingredient ID: NPC96576

Ingredient ID: NPC93633

Ingredient ID: NPC90112

Ingredient ID: NPC8962

Ingredient ID: NPC89422

Ingredient ID: NPC88759

Ingredient ID: NPC88686

Ingredient ID: NPC88481

Ingredient ID: NPC87439

Ingredient ID: NPC84955

Ingredient ID: NPC84938

Ingredient ID: NPC84908

Ingredient ID: NPC84462

Ingredient ID: NPC84398

Ingredient ID: NPC84158

Ingredient ID: NPC84024

Ingredient ID: NPC81511

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC78080

Ingredient ID: NPC77672

Ingredient ID: NPC76145

Ingredient ID: NPC76074

Ingredient ID: NPC75521

Ingredient ID: NPC75158

Ingredient ID: NPC75037

Ingredient ID: NPC73306

Ingredient ID: NPC72527

Ingredient ID: NPC72024

Ingredient ID: NPC71145

Ingredient ID: NPC64176

Ingredient ID: NPC63941

Ingredient ID: NPC60761

Ingredient ID: NPC54435

Ingredient ID: NPC51820

Ingredient ID: NPC5130

Ingredient ID: NPC48564

Ingredient ID: NPC46838

Ingredient ID: NPC44512

Ingredient ID: NPC44328

Ingredient ID: NPC41676

Ingredient ID: NPC41538

Ingredient ID: NPC39633

Ingredient ID: NPC38069

Ingredient ID: NPC37793

Ingredient ID: NPC37132

Ingredient ID: NPC3649

Ingredient ID: NPC34700

Ingredient ID: NPC34241

Ingredient ID: NPC34103

Ingredient ID: NPC33908

Ingredient ID: NPC32674

Ingredient ID: NPC323806

Ingredient ID: NPC321027

Ingredient ID: NPC320799

Ingredient ID: NPC320086

Ingredient ID: NPC315459

Ingredient ID: NPC311987

Ingredient ID: NPC310437

Ingredient ID: NPC308749

Ingredient ID: NPC307517

Ingredient ID: NPC305660

Ingredient ID: NPC300228

Ingredient ID: NPC300017

Ingredient ID: NPC299545

Ingredient ID: NPC299529

Ingredient ID: NPC299008

Ingredient ID: NPC29883

Ingredient ID: NPC298048

Ingredient ID: NPC29680

Ingredient ID: NPC293714

Ingredient ID: NPC293378

Ingredient ID: NPC292869

Ingredient ID: NPC292366

Ingredient ID: NPC291724

Ingredient ID: NPC291545

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC28913

Ingredient ID: NPC28598

Ingredient ID: NPC284720

Ingredient ID: NPC283923

Ingredient ID: NPC282731

Ingredient ID: NPC281131

Ingredient ID: NPC280943

Ingredient ID: NPC277867

Ingredient ID: NPC276465

Ingredient ID: NPC27501

Ingredient ID: NPC274613

Ingredient ID: NPC270077

Ingredient ID: NPC268862

Ingredient ID: NPC266020

Ingredient ID: NPC264145

Ingredient ID: NPC26229

Ingredient ID: NPC260995

Ingredient ID: NPC260052

Ingredient ID: NPC259293

Ingredient ID: NPC259011

Ingredient ID: NPC258130

Ingredient ID: NPC254848

Ingredient ID: NPC254159

Ingredient ID: NPC251501

Ingredient ID: NPC251256

Ingredient ID: NPC251059

Ingredient ID: NPC247266

Ingredient ID: NPC243990

Ingredient ID: NPC242580

Ingredient ID: NPC240431

Ingredient ID: NPC239479

Ingredient ID: NPC239406

Ingredient ID: NPC237812

Ingredient ID: NPC237365

Ingredient ID: NPC236579

Ingredient ID: NPC231944

Ingredient ID: NPC23049

Ingredient ID: NPC230301

Ingredient ID: NPC229786

Ingredient ID: NPC229646

Ingredient ID: NPC22903

Ingredient ID: NPC227250

Ingredient ID: NPC227211

Ingredient ID: NPC225783

Ingredient ID: NPC225710

Ingredient ID: NPC225467

Ingredient ID: NPC223455

Ingredient ID: NPC222628

Ingredient ID: NPC222538

Ingredient ID: NPC22229

Ingredient ID: NPC220523

Ingredient ID: NPC216105

Ingredient ID: NPC21566

Ingredient ID: NPC215377

Ingredient ID: NPC214608

Ingredient ID: NPC212195

Ingredient ID: NPC2121

Ingredient ID: NPC211519

Ingredient ID: NPC209971

Ingredient ID: NPC209054

Ingredient ID: NPC20791

Ingredient ID: NPC204759

Ingredient ID: NPC202967

Ingredient ID: NPC202956

Ingredient ID: NPC198658

Ingredient ID: NPC197978

Ingredient ID: NPC197811

Ingredient ID: NPC19756

Ingredient ID: NPC196924

Ingredient ID: NPC196776

Ingredient ID: NPC195265

Ingredient ID: NPC194861

Ingredient ID: NPC193335

Ingredient ID: NPC192944

Ingredient ID: NPC192695

Ingredient ID: NPC190974

Ingredient ID: NPC189206

Ingredient ID: NPC188238

Ingredient ID: NPC186653

Ingredient ID: NPC185339

Ingredient ID: NPC185189

Ingredient ID: NPC184643

Ingredient ID: NPC182571

Ingredient ID: NPC181153

Ingredient ID: NPC180133

Ingredient ID: NPC179950

Ingredient ID: NPC179694

Ingredient ID: NPC179365

Ingredient ID: NPC178026

Ingredient ID: NPC177874

Ingredient ID: NPC177726

Ingredient ID: NPC176730

Ingredient ID: NPC173651

Ingredient ID: NPC169749

Ingredient ID: NPC168855

Ingredient ID: NPC168579

Ingredient ID: NPC167400

Ingredient ID: NPC163866

Ingredient ID: NPC161700

Ingredient ID: NPC161393

Ingredient ID: NPC160789

Ingredient ID: NPC15698

Ingredient ID: NPC156630

Ingredient ID: NPC156461

Ingredient ID: NPC154401

Ingredient ID: NPC154186

Ingredient ID: NPC154185

Ingredient ID: NPC152759

Ingredient ID: NPC152451

Ingredient ID: NPC1507

Ingredient ID: NPC149198

Ingredient ID: NPC148825

Ingredient ID: NPC14867

Ingredient ID: NPC147156

Ingredient ID: NPC143586

Ingredient ID: NPC142691

Ingredient ID: NPC142103

Ingredient ID: NPC140454

Ingredient ID: NPC137887

Ingredient ID: NPC136996

Ingredient ID: NPC136531

Ingredient ID: NPC135353

Ingredient ID: NPC133966

Ingredient ID: NPC133961

Ingredient ID: NPC133671

Ingredient ID: NPC131524

Ingredient ID: NPC131372

Ingredient ID: NPC130683

Ingredient ID: NPC130628

Ingredient ID: NPC130444

Ingredient ID: NPC129206

Ingredient ID: NPC129165

Ingredient ID: NPC127122

Ingredient ID: NPC126759

Ingredient ID: NPC126681

Ingredient ID: NPC125755

Ingredient ID: NPC123175

Ingredient ID: NPC122962

Ingredient ID: NPC119949

Ingredient ID: NPC119866

Ingredient ID: NPC118004

Ingredient ID: NPC116775

Ingredient ID: NPC115216

Ingredient ID: NPC114648

Ingredient ID: NPC114239

Ingredient ID: NPC113219

Ingredient ID: NPC11119

Ingredient ID: NPC110895

Ingredient ID: NPC109813

Ingredient ID: NPC108612

Ingredient ID: NPC107840

Ingredient ID: NPC10781

Ingredient ID: NPC107482

Ingredient ID: NPC106381

Ingredient ID: NPC10636

Ingredient ID: NPC10183

Ingredient ID: NPC100980