• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Iris Sibirica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

CTCGTGTCGCTCCGCACCCCCCATCTCCTCCGGGGGAGGGAGGAAACATGCGGACGCGGAGATTGGCCCACCGTGCCTCGTGCGCGGCGGGCCGAAGTGCGGGCCGTCGTCGGGCCGGGCGCGGCGAGTGGTGGACGATGAAACATACGGCTCCTTCACCGTGCCCCGGCCCTCTAAAGCGCGACGCATCATGGCCCCGAGCTAGGGACCCCCTACCGGAAAGGGAGCGCGCGCGCACACGTGCGCCGCCTCCCTATCGGA
Taxonomic Information

Plant ID: NPO16727
Plant Latin Name: Iris Sibirica
Taxonomy Genus: Iris
Taxonomy Family: Iridaceae

Plant External Links:

NCBI TaxonomyDB: 198826
Plant-of-the-World-Online: 439087-1

Used in Medicines

Unknown.

Geographical Distribution

Canada; Turkey; Romania; Belarus; Italy; South Africa; Poland; Ukraine; Sweden; Mongolia; France; United States; Austria; Germany; Switzerland; Hungary; Kazakhstan; Russia; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

80 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


56 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94758

Ingredient ID: NPC90062

Ingredient ID: NPC81316

Ingredient ID: NPC80448

Ingredient ID: NPC79571

Ingredient ID: NPC78631

Ingredient ID: NPC7278

Ingredient ID: NPC7059

Ingredient ID: NPC664

Ingredient ID: NPC61954

Ingredient ID: NPC59668

Ingredient ID: NPC58865

Ingredient ID: NPC55233

Ingredient ID: NPC43160

Ingredient ID: NPC41689

Ingredient ID: NPC40000

Ingredient ID: NPC36922

Ingredient ID: NPC36856

Ingredient ID: NPC36352

Ingredient ID: NPC34687

Ingredient ID: NPC33406

Ingredient ID: NPC30896

Ingredient ID: NPC30654

Ingredient ID: NPC306418

Ingredient ID: NPC300342

Ingredient ID: NPC296558

Ingredient ID: NPC295723

Ingredient ID: NPC293201

Ingredient ID: NPC280284

Ingredient ID: NPC278556

Ingredient ID: NPC277205

Ingredient ID: NPC273423

Ingredient ID: NPC265411

Ingredient ID: NPC264428

Ingredient ID: NPC263337

Ingredient ID: NPC25257

Ingredient ID: NPC25141

Ingredient ID: NPC244088

Ingredient ID: NPC241202

Ingredient ID: NPC238428

Ingredient ID: NPC23695

Ingredient ID: NPC232977

Ingredient ID: NPC231410

Ingredient ID: NPC230301

Ingredient ID: NPC221774

Ingredient ID: NPC221661

Ingredient ID: NPC211074

Ingredient ID: NPC210934

Ingredient ID: NPC210688

Ingredient ID: NPC210450

Ingredient ID: NPC207362

Ingredient ID: NPC205468

Ingredient ID: NPC205125

Ingredient ID: NPC204868

Ingredient ID: NPC200505

Ingredient ID: NPC194208

Ingredient ID: NPC188947

Ingredient ID: NPC187870

Ingredient ID: NPC184049

Ingredient ID: NPC181540

Ingredient ID: NPC180300

Ingredient ID: NPC164727

Ingredient ID: NPC159362

Ingredient ID: NPC157776

Ingredient ID: NPC141944

Ingredient ID: NPC130913

Ingredient ID: NPC125269

Ingredient ID: NPC125108

Ingredient ID: NPC12483

Ingredient ID: NPC124588

Ingredient ID: NPC119663

Ingredient ID: NPC118968

Ingredient ID: NPC114014

Ingredient ID: NPC110396

Ingredient ID: NPC110250

Ingredient ID: NPC107662

Ingredient ID: NPC106047

Ingredient ID: NPC10331

Ingredient ID: NPC102895

Ingredient ID: NPC101680