• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Dalbergia Hupeana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCATTGTCGATGCCTCAATCCAGAGAGACCCGCGAACGCGTTTCACTACCGGGGACGGTCGGAGCTGCCTGGCAGCCCGCCTTCCCCAAGAGTCGGGACCGAGTCACGCCCAGGCGGTCTCGTCCCGGCGCAACAACAACAAACCCCGGCGCGGAATGCGCCAAGGAAGCAACAATCGTAGAGCGCGCCCCGTCGACCCGGCAACGGTGCTCGTACGGGTGATGTCGCAACACTCGAGTCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACAATCGCCGCCCCAACCCCCGCGCCTCCGGGCACGGAGCGGGGCGAATGATGGCTTCCCGTGAGCACCGCCTCGCGGCTGGCTGAAAATCGGGTCCGTGGCGGAAGCAGCGCCATGACAGATGGTGGTTGAGCGTGTTCTCGAGGCCAGTCGTGCGCGCGGCCTCCGCCAGCTCCGTACCCAGTGACCCGCGAGCGACGTCGATCGCCCATGACGCGACCTCAGGTCAGGCGG

Click for details-----ITS1

GACCTGCGGAGGATCATTGTCGATGCCTCAATCCAGAGAGACCCGCGAACGCGTTTCACTACCGGGGACGGTCGGAGCTGCCCGGCAGCCCGCCTTCCCCAAGAGTCGGGACCGAGTCACGCCCAGGCGGTCTCGTCCCGGCGCAACAACAACAAACCCCGGCGCGGAATGCGCCAAGGAAGCAACAATCGTAGAGCGCGCCCCGTCGACCCGGCAACGGTGCTCGTACGGGYGATGTCGCAACACTCGAGTCCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO16725
Plant Latin Name: Dalbergia Hupeana
Taxonomy Genus: Dalbergia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 53863
Plant-of-the-World-Online: 490264-1

Used in Medicines

Unknown.

Geographical Distribution

South Africa; China; Vietnam; Laos

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

13 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97094

Ingredient ID: NPC71015

Ingredient ID: NPC50403

Ingredient ID: NPC294852

Ingredient ID: NPC260225

Ingredient ID: NPC254847

Ingredient ID: NPC250796

Ingredient ID: NPC246162

Ingredient ID: NPC20791

Ingredient ID: NPC143799

Ingredient ID: NPC125062

Ingredient ID: NPC116775

Ingredient ID: NPC10357