CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Plumbago Indica

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTCGAAACCTCTCAACCGAACGACCCGAGAACACGTTCCCTCACACAACCATCTTGTCGGGGCGTCGGCTCACCTCGTGCTGTCCGACGCCCAGGCTTGAACAAAAACACGGCGCGGGTTGCGCCAAGGACGAACCAATGTTTTAACCTTGCCGTGCCCCCCACCGTCCTTCGGCCCGGGGAGCGCGCGCGGTTGGCAAACACGATAACTTTTAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCATGCATCGCGTCGCCACCCCAGCCACCCTAAACCGGTGGTCCGCGGGGGCGTAATGTGGCCCTCCGTGCACTCGAATGCGCGGTTGGCTTAAATTCGGGGCCTGCGGCAGCGAGCGCCGCGGCAATTGGGTGGTTTATAATGGCTACGTCTTGCCGCGAAGCGTCGTGCCGCCACGGCCCGCTCGACCCAAACGATCCACCATGCGACCCCAGGTC

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCCACCCCAGCCACCCTAAACCGGTGGTCCGCGGGGGCGTAATGTGGCCCTCCGTGCACTCGAATGCGCGGTTGGCTTAAATTCGGGGCCTGCGGCAGCGAGCGCCGCGGCAATTGGGTGGTTTATAATGGCTACGTCTTGCCGCGAAGCGTCGTGCCGCCACGGCCCGCTCGACCCAAACGATCCACCATGCGACCCCAGGTC

Taxonomic Information

Plant ID: NPO16662
Plant Latin Name: Plumbago Indica
Taxonomy Genus: Plumbago
Taxonomy Family: Plumbaginaceae

Plant External Links:

NCBI TaxonomyDB: 122308
Plant-of-the-World-Online: 687077-1

Used in Medicines

Country/Region:

Thailand; China; India

Traditional Medicine System:

Indian Folk; TCM; Unani; Ayurveda; Siddha

Geographical Distribution

Bangladesh; India; Cambodia; Trinidad and Tobago; China; Peru; Thailand

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

24 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99325

Ingredient ID: NPC9415

Ingredient ID: NPC92418

Ingredient ID: NPC6984

Ingredient ID: NPC56294

Ingredient ID: NPC37496

Ingredient ID: NPC32739

Ingredient ID: NPC286177

Ingredient ID: NPC285829

Ingredient ID: NPC285456

Ingredient ID: NPC257993

Ingredient ID: NPC23871

Ingredient ID: NPC229646

Ingredient ID: NPC195828

Ingredient ID: NPC194637

Ingredient ID: NPC184359

Ingredient ID: NPC182776

Ingredient ID: NPC1770

Ingredient ID: NPC162671

Ingredient ID: NPC16134

Ingredient ID: NPC135618

Ingredient ID: NPC125286

Ingredient ID: NPC111494

Ingredient ID: NPC109622

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR1	Estrogen receptor alpha	P03372	CHEMBL206
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Protein Phosphatase	CDC25A	Dual specificity phosphatase Cdc25A	P30304	CHEMBL3775
Therapeutic Target	Transient receptor potential channel	TRPA1	Transient receptor potential cation channel subfamily A member 1	O75762	CHEMBL6007

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04677855	Study of PCUR-101 in Combination With ADT in Patients With mCRPC	prostate cancer	Plumbagin (NPC285829)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ESR2,ACHE,TRPA1,TP53,CDC25A,CACNA1G
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CACNA1H,ACHE,TRPA1,CDC25A,CYP2C19,CACNA1G
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	ESR2,TRPA1,TP53,CDC25A,MAPT
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CDC25A,MAPT,CACNA1G,CDC25A,MAPT
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,TRPA1,CDC25A,MAPT,CACNA1G
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	ACHE,TRPA1,CDC25A,TST,CACNA1G
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ESR2,ACHE,CDC25A,CYP2C19
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CACNA1H,ESR1,TRPA1,CDC25A
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	CACNA1H,ESR1,TP53
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	ESR2,ESR1 NCT04677855
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MAPT,ACHE,ESR2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TRPA1,TP53,CACNA1G
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ESR1,TP53,CDC25A
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE,CDC25A,MAPT
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,TRPA1,TRPA1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CDC25A,ACHE,TRPA1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	TP53,ESR1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	ESR1,ESR2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR1,ESR2
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TP53,CACNA1H
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR1,ESR2
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE,MAPT
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	MAPT,TP53
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	CACNA1H,ACHE
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	TP53,CACNA1G
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE,MAPT
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CDC25A,TRPA1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CDC25A,TRPA1
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CDC25A,ACHE
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	TRPA1,ESR1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE,CACNA1G
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CDC25A,CACNA1G
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	TP53
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	TP53
Skeletal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD24	ESR1
Acidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C73	CACNA1H
Vaginitis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA02	ESR1
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	ESR1
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	ESR1
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CACNA1G
Breast in situ carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65	ESR1
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	CACNA1G
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	TP53
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TP53
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	TP53
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	ESR1
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	ESR1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CACNA1G
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	TP53
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	ESR1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	TRPA1
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESR2
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	TP53
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	ESR1
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TP53
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	MAPT
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	CACNA1G
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Metastatic tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E2Z	ESR1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	ESR1
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2
Female infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA31	ESR1
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Dyspareunia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA12	ESR1
Epilepsy/seizure Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A61-8A6Z	CACNA1G
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	ESR2
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Menstrual cycle bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20	ESR1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	CACNA1H
Female genital tract noninflammatory disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA1Y	ESR1
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53
Male infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB04	ESR1
Upper respiratory tract disorder Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0Z	TRPA1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	TRPA1
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	CACNA1H
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CDC25A
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	TRPA1
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	CACNA1G
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDC25A
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	TRPA1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CACNA1H
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	TRPA1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CDC25A
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CDC25A
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	CDC25A
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CDC25A
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CACNA1G

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Plumbago Indica

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

24 All known Ingredients in Total

24 Ingredients with Acceptable Bioavailablity

6 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Malignant neoplasms of biliary tract, distal bile duct

Hepatocellular carcinoma of liver

Malignant neoplasms of thymus

Germ cell tumour of testis

Cytomegaloviral disease

Invasive carcinoma of breast

Brain cancer

Prostate cancer

Alzheimer disease

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of bronchus or lung

Solid tumour/cancer

Breast cancer

Hyper-lipoproteinaemia

Ovarian cancer

Menopausal disorder

Mild neurocognitive disorder

Acute myeloid leukaemia

Pain, unspecified

Pancreatic cancer

Parkinsonism

Squamous cell carcinoma of bronchus or lung

Mesothelioma of pleura

Malignant neoplasms of oesophagus

Carpal tunnel syndrome

Ebola virus disease

Malignant neoplasms of adrenal gland

Mature B-cell leukaemia

Substance abuse

Head and neck cancer

Skeletal anomaly

Acidosis

Vaginitis

Oesophageal/gastroduodenal disorder

Cervical cancer

Pediculosis

Pituitary gland disorder

Dementia

Unspecified viral infection of unspecified site

Metastatic liver/bile duct neoplasm

Schizophrenia

Breast in situ carcinoma

Multiple structural anomalies syndrome

Unspecific substance harmful effect

Myasthenia gravis

Stomach cancer

Parasitic worm infestation

Myelodysplastic syndrome

Peritoneal cancer

Low bone mass disorder

Bladder cancer

Esophageal cancer

Endometriosis

Insomnia

Malignant haematopoietic neoplasm

Acquired prion disease

Indeterminate colitis