• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rubia Yunnanensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGAATCCTGAACGGCCGACCGCGAACACGTTCCTGAAAACCGCGCCGGGGAGCCGGGCCATCTGGCCGGGCGAGCCGCGCGCGCCAACCCCTCACTCTCGGCGCGAGAAGCGCCAAGGACTACTCGGACCGGATCCGGCGGCGTCCCCCGCGGCTTCCGCGGCGGGATCCCCCGGCATCTGATGAAACGTAACCAACACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCGCCACCCCCTCCTCCCCGTCGTCCTCCGGGACGCCGGCTGGCAGCGGGGCGGCGGATGCTGGCCTCCCGTTCCCCCGCGGCGCGGCTGGCCCAAATGCTTCGGCCCCCGGACGAGGGACGTCACGACTCAAGGTGGTTGGACATGTTTGTTTCATTCATTGAGGAGCCGTGACGGCCCCCGGGGCGCCCCCTCGAAAGACCCCAGTGGAGAGCAGTGGCCTCCGACCGCGACCCCAGGTCAGGC

Click for details-----ITS1

NA

Click for details-----ITS2

ATCTCGTCGCCACCCCCTCCTCCCCGTCGTCCTCCGGGACGCCGGCTGGCAGCGGGGCGGCGGATGCTGGCCTCCCGTTCCCCCGCGGCGCGGCTGGCCCAAATGCTTCGGCCCCCGGACGAGGGACGTCACGACTCAAGGTGGTTGGACATGTTTGTTTCATTCATTGAGGAGCCGTGACGGCCCCCGGGGCGCCCCCTCGAAAGACCCCAGTGGAGAGCAGTGGCCTCCGACCGCGACCCCAGGTCAGGC
Taxonomic Information

Plant ID: NPO16607
Plant Latin Name: Rubia Yunnanensis
Taxonomy Genus: Rubia
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 1650721
Plant-of-the-World-Online: 765385-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

105 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


52 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

53 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98973

Ingredient ID: NPC94529

Ingredient ID: NPC93015

Ingredient ID: NPC92146

Ingredient ID: NPC9200

Ingredient ID: NPC86356

Ingredient ID: NPC85811

Ingredient ID: NPC85488

Ingredient ID: NPC84319

Ingredient ID: NPC76071

Ingredient ID: NPC75689

Ingredient ID: NPC71633

Ingredient ID: NPC67469

Ingredient ID: NPC65405

Ingredient ID: NPC64140

Ingredient ID: NPC63295

Ingredient ID: NPC53414

Ingredient ID: NPC53206

Ingredient ID: NPC51700

Ingredient ID: NPC50548

Ingredient ID: NPC477860

Ingredient ID: NPC475571

Ingredient ID: NPC475178

Ingredient ID: NPC473678

Ingredient ID: NPC4683

Ingredient ID: NPC44437

Ingredient ID: NPC42682

Ingredient ID: NPC32064

Ingredient ID: NPC311308

Ingredient ID: NPC310904

Ingredient ID: NPC307050

Ingredient ID: NPC304899

Ingredient ID: NPC298229

Ingredient ID: NPC293453

Ingredient ID: NPC286620

Ingredient ID: NPC28516

Ingredient ID: NPC284537

Ingredient ID: NPC278628

Ingredient ID: NPC276120

Ingredient ID: NPC274242

Ingredient ID: NPC26726

Ingredient ID: NPC265736

Ingredient ID: NPC261571

Ingredient ID: NPC261141

Ingredient ID: NPC257582

Ingredient ID: NPC253115

Ingredient ID: NPC252776

Ingredient ID: NPC248886

Ingredient ID: NPC246110

Ingredient ID: NPC24483

Ingredient ID: NPC24475

Ingredient ID: NPC243728

Ingredient ID: NPC24277

Ingredient ID: NPC242728

Ingredient ID: NPC242627

Ingredient ID: NPC242162

Ingredient ID: NPC235211

Ingredient ID: NPC234069

Ingredient ID: NPC231530

Ingredient ID: NPC231285

Ingredient ID: NPC230301

Ingredient ID: NPC229281

Ingredient ID: NPC228629

Ingredient ID: NPC228346

Ingredient ID: NPC225195

Ingredient ID: NPC223300

Ingredient ID: NPC219046

Ingredient ID: NPC213058

Ingredient ID: NPC209802

Ingredient ID: NPC20853

Ingredient ID: NPC208358

Ingredient ID: NPC197428

Ingredient ID: NPC196776

Ingredient ID: NPC196673

Ingredient ID: NPC193830

Ingredient ID: NPC190554

Ingredient ID: NPC182882

Ingredient ID: NPC17936

Ingredient ID: NPC175928

Ingredient ID: NPC174122

Ingredient ID: NPC168390

Ingredient ID: NPC166179

Ingredient ID: NPC165822

Ingredient ID: NPC158835

Ingredient ID: NPC155974

Ingredient ID: NPC15390

Ingredient ID: NPC153413

Ingredient ID: NPC152358

Ingredient ID: NPC149962

Ingredient ID: NPC144314

Ingredient ID: NPC144068

Ingredient ID: NPC142956

Ingredient ID: NPC138083

Ingredient ID: NPC135174

Ingredient ID: NPC128665

Ingredient ID: NPC126878

Ingredient ID: NPC123965

Ingredient ID: NPC123859

Ingredient ID: NPC122266

Ingredient ID: NPC122262

Ingredient ID: NPC119508

Ingredient ID: NPC118353

Ingredient ID: NPC114188

Ingredient ID: NPC112552

Ingredient ID: NPC105495