• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Avena Sativa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTGACCTTGACTWAAACAGACTGCGCACGCGTTATCTATCCGCCCAGCTGCGGCACCGTCCGTTGCTCGGCAAAGTCCTCGATAACCTCCTCTCCTAGGGATGGGGGCTCGGGGTAAAAGAACCCACGATGCAAAAGGCGTCAAGGAACACTGTGCCTAGCTCGGTGATGCGGCTGGCTTGCTAGCCGCTTCACGTGCTTCAAAGCTATTTAATCCACACAACTCWCGGCAACAGATATCTCGGCTCTCGCATCGATGAAGAACATAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACACAAGTTGCACCCGAGCCATTCGGCCGAGGGCACGCCTGCTTGGGCATCACGCTAAACACGCTCCCACACTCTCATCGAGGAACAGGATGCGGCATTTGGCCTCCCGTCACGCAAGGGGCGGTGGGCAGAAGATATGGCTGCCGGCGCATCGTGCCAGACACAGCWCATGGTGAGCGACCTCGCTTTACTTACCACAGTGCGCCGACGCGTAGCCRACATGATGGCHTCGTAGACCCTTTGAACGGTGCGCAAGACGCTCCGACC

Click for details-----ITS1

TCGTGACCTTGACTWAAACAGACTGCGCACGCGTTATCTATCCGCCCAGCTGCGGCACCGTCCGTTGCTCGGCAAAGTCCTCGATAACCTCCTCTCCTAGGGATGGGGGCTCGGGGTAAAAGAACCCACGATGCAAAAGGCGTCAAGGAACACTGTGCCTAGCTCGGTGATGCGGCTGGCTTGCTAGCCGCTTCACGTGCTTCAAAGCTATTTAATCCACA

Click for details-----ITS2

TAAACACGCTCCCAACCCCTTACGGGGGAACAGGATGCGGCATTTGGCTCCCCGTCACCCAAGGGCGGTGGGCCGAAGATATGGCTGCCGGCGCATCGTGTCGGACACAGCGCGTGGTGAGCGTCCTCGCTATACTTACCGCAGTGTCTCCGACACATAGCCGGCGTGATGGCCTAGTAAAGACCCTTGAAACGGTGCGCATGACGCTCCGACC
Taxonomic Information

Plant ID: NPO16509
Plant Latin Name: Avena Sativa
Taxonomy Genus: Avena
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 4498
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Canada; Madagascar; Italy; South Africa; India; Lebanon; United States; Zimbabwe; Jordan; Swaziland; Angola; China; Spain

Traditional Medicine System:
Indian Folk; TCM; Homeopathy


Medicinal Functions:

Anticholesterolemic; Antidiarrhoeal; Antirheumatic; Antiseborrheic; Antispasmodic; Cancer; Cardiac; Diuretic; Emollient; Hypoglycaemic; Nervine; Nutritive; Poultice; Stimulant

Geographical Distribution

Canada; Turkey; Madagascar; Italy; South Africa; Lebanon; India; United States; Zimbabwe; China; Angola; Swaziland; Jordan; Spain

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

115 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


93 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

78 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95589

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC85813

Ingredient ID: NPC81930

Ingredient ID: NPC81414

Ingredient ID: NPC81010

Ingredient ID: NPC78312

Ingredient ID: NPC76336

Ingredient ID: NPC74599

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC5502

Ingredient ID: NPC52472

Ingredient ID: NPC50496

Ingredient ID: NPC50315

Ingredient ID: NPC491218

Ingredient ID: NPC490427

Ingredient ID: NPC490351

Ingredient ID: NPC490332

Ingredient ID: NPC490321

Ingredient ID: NPC490288

Ingredient ID: NPC489928

Ingredient ID: NPC489907

Ingredient ID: NPC4294

Ingredient ID: NPC424

Ingredient ID: NPC39064

Ingredient ID: NPC34908

Ingredient ID: NPC33666

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC309330

Ingredient ID: NPC300326

Ingredient ID: NPC300059

Ingredient ID: NPC29883

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293628

Ingredient ID: NPC291473

Ingredient ID: NPC290319

Ingredient ID: NPC287287

Ingredient ID: NPC281686

Ingredient ID: NPC27836

Ingredient ID: NPC273019

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC265305

Ingredient ID: NPC263495

Ingredient ID: NPC260569

Ingredient ID: NPC260000

Ingredient ID: NPC245346

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC230479

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC222889

Ingredient ID: NPC221411

Ingredient ID: NPC220765

Ingredient ID: NPC219913

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC210267

Ingredient ID: NPC209560

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203719

Ingredient ID: NPC203468

Ingredient ID: NPC202431

Ingredient ID: NPC201844

Ingredient ID: NPC199072

Ingredient ID: NPC197087

Ingredient ID: NPC193989

Ingredient ID: NPC193536

Ingredient ID: NPC189436

Ingredient ID: NPC185755

Ingredient ID: NPC17810

Ingredient ID: NPC174246

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC160353

Ingredient ID: NPC158079

Ingredient ID: NPC156751

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC146422

Ingredient ID: NPC141765

Ingredient ID: NPC140753

Ingredient ID: NPC140154

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC134452

Ingredient ID: NPC133183

Ingredient ID: NPC130683

Ingredient ID: NPC126918

Ingredient ID: NPC126681

Ingredient ID: NPC126409

Ingredient ID: NPC126029

Ingredient ID: NPC125449

Ingredient ID: NPC121522

Ingredient ID: NPC118429

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC109699