• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lycium Cestroides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTTCAACACTGGGGAGCCGCGCGGGCGGGGTGCTTCGGCCCCCCGYGCGTGCGTCTCCCCCTCGTCCCCGGCGCGCGCGCCCGCGTGCGCGTCGGGTGACTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACCTAAATTGACAGCCTGCCTCTCGCGCCCCGTCCGCGGCGCGCGCGGGAGGGCCTGTGCTTCTTTTGAAACAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCGCGCACCGCGCCCGTACTCTGGGTCGTGGTGGTGTCGCGGGGCGGATGCTGGCCTCCCGTGCGCCTCGCGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCTCGAAGTGCCGTGGCTACGCCCCGTCGCGCGTTTGGCCTCCCGGACCCTTCTTGCGCTTAGGCGCTCCGA

Click for details-----ITS1

TGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTTCAACACTGGGGAGCCGCGCGGGCGGGGTGCTTCGGCCCCCCGYGCGTGCGTCTCCCCCTCGTCCCCGGCGCGCGCGCCCGCGTGCGCGTCGGGTGACTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACCTAAATTGACAGCCTGCCTCTCGCGCCCCGTCCGCGGCGCGCGCGGGAGGGCCTGTGCTTCTTTTGAAACAAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCGCGCACCGCGCCCGTACTCTGGGTCGTGGTGGTGTCGCGGGGCGGATGCTGGCCTCCCGTGCGCCTCGCGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCTCGAAGTGCCGTGGCTACGCCCCGTCGCGCGTTTGGCCTCCCGGACCCTTCTTGCGCTTAGGCGCTCCGA
Taxonomic Information

Plant ID: NPO16453
Plant Latin Name: Lycium Cestroides
Taxonomy Genus: Lycium
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 33116
Plant-of-the-World-Online: 816386-1

Used in Medicines

Unknown.

Geographical Distribution

Bolivia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

76 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


61 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

23 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99587

Ingredient ID: NPC91495

Ingredient ID: NPC87475

Ingredient ID: NPC85571

Ingredient ID: NPC83838

Ingredient ID: NPC81419

Ingredient ID: NPC75078

Ingredient ID: NPC73617

Ingredient ID: NPC72675

Ingredient ID: NPC7183

Ingredient ID: NPC70400

Ingredient ID: NPC69918

Ingredient ID: NPC63100

Ingredient ID: NPC617

Ingredient ID: NPC57891

Ingredient ID: NPC51004

Ingredient ID: NPC48666

Ingredient ID: NPC47584

Ingredient ID: NPC38771

Ingredient ID: NPC3658

Ingredient ID: NPC35270

Ingredient ID: NPC35022

Ingredient ID: NPC309493

Ingredient ID: NPC30869

Ingredient ID: NPC307411

Ingredient ID: NPC30560

Ingredient ID: NPC30515

Ingredient ID: NPC301058

Ingredient ID: NPC300389

Ingredient ID: NPC286137

Ingredient ID: NPC282431

Ingredient ID: NPC274773

Ingredient ID: NPC272814

Ingredient ID: NPC271852

Ingredient ID: NPC267403

Ingredient ID: NPC25245

Ingredient ID: NPC24251

Ingredient ID: NPC239809

Ingredient ID: NPC236208

Ingredient ID: NPC231889

Ingredient ID: NPC226535

Ingredient ID: NPC221758

Ingredient ID: NPC221231

Ingredient ID: NPC208886

Ingredient ID: NPC20713

Ingredient ID: NPC202868

Ingredient ID: NPC202688

Ingredient ID: NPC202672

Ingredient ID: NPC194977

Ingredient ID: NPC192501

Ingredient ID: NPC191448

Ingredient ID: NPC186080

Ingredient ID: NPC184102

Ingredient ID: NPC179746

Ingredient ID: NPC176414

Ingredient ID: NPC173602

Ingredient ID: NPC171147

Ingredient ID: NPC17039

Ingredient ID: NPC162742

Ingredient ID: NPC161193

Ingredient ID: NPC157982

Ingredient ID: NPC15669

Ingredient ID: NPC151709

Ingredient ID: NPC141810

Ingredient ID: NPC137946

Ingredient ID: NPC135484

Ingredient ID: NPC128897

Ingredient ID: NPC12256

Ingredient ID: NPC12172

Ingredient ID: NPC117853

Ingredient ID: NPC115827

Ingredient ID: NPC112065

Ingredient ID: NPC111703

Ingredient ID: NPC107069

Ingredient ID: NPC106770

Ingredient ID: NPC101035