CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Picea Rubens

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTGTTTTKGAGGGGGGATGAAAGCAGCGCGCTGTTGGACTGGCCACCCTAGTCCCCCCTTGATCGTCGTTCCCTTCAAGTCCCCCTCTCGAGTTGAGGTCATGGAAAGCTTGCTCTGTTTGTTCGAGCCTCCTGTGTACGGAGGGGGAGTGCATATGTCTTGTGGGGTGGGAGGGTTGTTGTCATTTGCGGTGCTGTGTGCATCGTGGGATTTTCCATTGGTCGCATGGACGCCTTGTCTAGCGAAGTGGGGGTTCGTCGGTAACGTGAGGAAATGACTCTCGGCAACGGATATCTCGGCTCTTGTCACGATGAAGAACGTAGCGAAATGCGATACTTAGTGTGAATTGCAGAATCCCGTGAATCATCGAGTTTTTGAACGCAATTTGCGCCCGAGGCCTCGGTCGAGGGCACGTCTGTCTGGGCGTCGCATCCWACAWACACGCGCTCCCTGCAAGGCATGGGGGAGGAGCGGAGATGKTCGTCCGTTCCCAACGTGGTTCGGTCGGCTGAAAAACATGCCATGTTCCGTGTCTTGTGTCGGCGAGCGGTGATATTGTCCCCTTGTTGGGGCGAGTCGGCGTTGGTTGATGCAGGGTGTGTGCAGCATTTCGGGAACTTGCTTTGCCCATCGACTTTCCATCTTGGTGGAGGTCTTTGGCTCCAAATGCGACCCCAGCTCAGGCGAGAACACCCG

Click for details-----ITS1

Click for details-----ITS2

CCWACAWACACGCGCTCCCTGCAAGGCATGGGGGAGGAGCGGAGATGKTCGTCCGTTCCCAACGTGGTTCGGTCGGCTGAAAAACATGCCATGTTCCGTGTCTTGTGTCGGCGAGCGGTGATATTGTCCCCTTGTTGGGGCGAGTCGGCGTTGGTTGATGCAGGGTGTGTGCAGCATTTCGGGAACTTGCTTTGCCCATCGACTTTCCATCTTGGTGGAGGTCTTTGGCTCCAAATGCGACCCCAGCTCAGGCGAGAACACCCG

Taxonomic Information

Plant ID: NPO16380
Plant Latin Name: Picea Rubens
Taxonomy Genus: Picea
Taxonomy Family: Pinaceae

Plant External Links:

NCBI TaxonomyDB: 3333
Plant-of-the-World-Online: 195909-2

Used in Medicines

Unknown.

Geographical Distribution

Canada; United States

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

5 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

2 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

4 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC281131

Ingredient ID: NPC264145

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC212490

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lysine demethylase	KDM4E	Lysine-specific demethylase 4D-like	B2RXH2	CHEMBL1293226
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transferase	FUT7	Alpha-(1,3)-fucosyltransferase 7	Q11130	CHEMBL3596077

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TDP1,HSD17B10,ACHE,LMNA
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	FUT7,HSD17B10,TDP1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	FUT7,LMNA,ACHE
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	FUT7,LMNA,TDP1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FUT7,HSD17B10,ACHE
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	FUT7,TDP1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	FUT7,ACHE
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,FUT7
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,ACHE
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KDM4E,ACHE
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	FUT7,ACHE
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT01705652
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	FUT7
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FUT7
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FUT7
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	FUT7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FUT7
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FUT7

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Picea Rubens

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

5 All known Ingredients in Total

2 Ingredients with Acceptable Bioavailablity

4 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Carcinosarcoma of uterus

Adenocarcinoma of pancreas

Mesothelioma of pleura

Malignant neoplasms of thymus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Other specified malignant neoplasms of kidney, except renal pelvis

Superficial ovarian endometriosis

Cytomegaloviral disease

Germ cell tumour of testis

Dementia

Glaucoma

Pediculosis

Alzheimer disease

Oesophageal/gastroduodenal disorder

Parasitic worm infestation

Substance abuse

Pain, unspecified

Myasthenia gravis

Parkinsonism

Unspecific substance harmful effect

Mild neurocognitive disorder

Prostate cancer

Zika virus disease

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

West Nile virus infection

Melanoma of skin

Malignant neoplasms of oesophagus

Systemic lupus erythematosus

Adenocarcinoma of bronchus or lung

Chikungunya virus disease

Polycystic ovary syndrome

Invasive carcinoma of breast

Glioblastoma of brain

Carpal tunnel syndrome

Ebola virus disease

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities