• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Amomum Xanthioides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTGAGAGCACTGAACAATGGATGATTGTGAACGTGTCAACATGCCCCTCTACTTGGCCCCATTTTGGTGGCCGACTGACCATAGCTCGGTGCGATCGGCACCAAGGAACAATGAACTCAGAAGCAGAGGGCCCTCGGTGTGCCCGGGGAGCCCACTGCGTCAGAGACGGTCGGAATCGAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCTCGTGAACCATTGAGTCTTTGAACGCAAGTTGTGCCCAAGGCTTTGTGGCCGAGGGCACGCCTGCTTGGGCGTCATGGCAACATCGCCTTTGCTCCTTGCTTTGCTGGTGCGAAGAGCGGAAATTGGCCTCGTGTGCCCTCGGGCACAGTCGGTCGAAGAGCGGGTAGTCGGCAGTCGTCGGGCGCGATGGGTGCTGGTCACCCTGCGCGTGAATAGAACGTCGCCCCGACGTGTTGGGATGTTTCCTCAAAGAGACCCTGTGCGATTGCGGCATCATGTCAAAGTGACGTGCCCATCGGATTGTGGCCCCAAGTCAGGCGAGGCCCACCCGCCGAGTTTAA

Click for details-----ITS1

TTGWGAGAGCACTGAACAATGGATGRTTGTGAACGTGTCAACRTGCCCCTCTACTTGGCCCCATTTTGGTGGCCGACTGACCATAGCTCGGTGCGATCGGCACCAAGGAACAATGAACTCAGAAGCAGAKGGCCCTCGGTGTGCCCGGGGAGCCCACTGCGTCRGAGACGGTCGGAATCGAA

Click for details-----ITS2

CAACATCGCCTTTGCTCCTTGCTTTGCTGGTGCGAAGAGCGGAAATTGGCCTCGTGTGCCCTCGGGCACAGTCGGTCGAAGAGCGGGTAGTCGGCAGTCGTCGGGCGCGATGGGTGCTGGTCACCCTGCGCGTGAATAGAACGTCGCCCCGACGTGTTGGGATGTTTCCTCAAAGAGACCCTGTGCGATTGCGGCATCATGTCAAAGTGACGTGCCCATCGGATTGTGGCCCCAAGTCAGGCGAGGCCCACCCGCCGAGTTTAA
Taxonomic Information

Plant ID: NPO1631
Plant Latin Name: Amomum Xanthioides
Taxonomy Genus: Amomum
Taxonomy Family: Zingiberaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; Vietnam; India; China; Laos

Traditional Medicine System:
Kampo; Indian Folk; TCM; Ayurveda; Siddha

Geographical Distribution

India; Vietnam; China; Thailand; Laos

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

141 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


125 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

66 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC95675

Ingredient ID: NPC89069

Ingredient ID: NPC87828

Ingredient ID: NPC84030

Ingredient ID: NPC81500

Ingredient ID: NPC78551

Ingredient ID: NPC76765

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70291

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC66577

Ingredient ID: NPC61828

Ingredient ID: NPC61779

Ingredient ID: NPC61769

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC57877

Ingredient ID: NPC54264

Ingredient ID: NPC51758

Ingredient ID: NPC51189

Ingredient ID: NPC50629

Ingredient ID: NPC45727

Ingredient ID: NPC44751

Ingredient ID: NPC43635

Ingredient ID: NPC43453

Ingredient ID: NPC43114

Ingredient ID: NPC40249

Ingredient ID: NPC3936

Ingredient ID: NPC38278

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC32762

Ingredient ID: NPC325439

Ingredient ID: NPC325196

Ingredient ID: NPC319957

Ingredient ID: NPC3155

Ingredient ID: NPC310194

Ingredient ID: NPC309182

Ingredient ID: NPC308297

Ingredient ID: NPC308218

Ingredient ID: NPC307011

Ingredient ID: NPC304885

Ingredient ID: NPC300649

Ingredient ID: NPC299724

Ingredient ID: NPC298062

Ingredient ID: NPC297844

Ingredient ID: NPC297527

Ingredient ID: NPC293343

Ingredient ID: NPC292952

Ingredient ID: NPC290613

Ingredient ID: NPC290437

Ingredient ID: NPC290189

Ingredient ID: NPC29

Ingredient ID: NPC289366

Ingredient ID: NPC287550

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC277917

Ingredient ID: NPC276707

Ingredient ID: NPC274012

Ingredient ID: NPC26906

Ingredient ID: NPC260000

Ingredient ID: NPC258672

Ingredient ID: NPC254293

Ingredient ID: NPC252230

Ingredient ID: NPC249009

Ingredient ID: NPC247786

Ingredient ID: NPC241838

Ingredient ID: NPC240009

Ingredient ID: NPC239039

Ingredient ID: NPC237705

Ingredient ID: NPC235976

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC223468

Ingredient ID: NPC219400

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC211567

Ingredient ID: NPC210831

Ingredient ID: NPC209970

Ingredient ID: NPC209275

Ingredient ID: NPC200740

Ingredient ID: NPC197896

Ingredient ID: NPC196490

Ingredient ID: NPC190810

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC187061

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC179950

Ingredient ID: NPC179103

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC176309

Ingredient ID: NPC175987

Ingredient ID: NPC173996

Ingredient ID: NPC173637

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC15970

Ingredient ID: NPC157298

Ingredient ID: NPC156461

Ingredient ID: NPC152989

Ingredient ID: NPC152005

Ingredient ID: NPC150465

Ingredient ID: NPC148303

Ingredient ID: NPC147343

Ingredient ID: NPC14682

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC139337

Ingredient ID: NPC138113

Ingredient ID: NPC136232

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC126240

Ingredient ID: NPC120926

Ingredient ID: NPC115469

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC111888

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC105557

Ingredient ID: NPC100445