CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Leptochloa Digitata

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGTGACCCTGACCAAAACAGACCGTGAACATGTCATCCATGCTGCCGGGTGATGGGACTTGCACCCATCTCCCGGTCTAGGCCACCGACCTTCATCCAGAGGGACGGGGGCCGAAAAGAACCCACGGCGCTGTATGGCGTCAAGGAAAACTAATATTGCCTTGCTCGGGGATGTGGCCGGCTTGCCGGACGCACCCTGTGCAGCGATGCTATGTAAAATCACATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACCTGGTGTGAATTGCAGAATCCCGTGAACCATTGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTTTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCCAAAAGACACTCCACACCCATCCCCGGTGTGGACGTGGTGTTTGGCCCCTCATGCCATACGGTGTGGTGGGTCAAAGATGGGGCTGCCGACGGTGTCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGTTACGATCGAAACCACTCCTCGGTGAAGTTATGGCCCTATGGACCCATGCATCGGAGCGCATGTCGCTCGGA

Click for details-----ITS1

Click for details-----ITS2

CAAAAGACACTCCACACCCATCCCCGGTGTGGACGTGGTGTTTGGCCCCTCATGCCATACGGTGTGGTGGGTCAAAGATGGGGCTGCCGACGGTGTCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGTTACGATCGAAACCACTCCTCGGTGAAGTTATGGCCCTATGGACCCATGCATCGGAGCGCATGTCGCTCGGA

Taxonomic Information

Plant ID: NPO16291
Plant Latin Name: Leptochloa Digitata
Taxonomy Genus: Leptochloa
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 1245302
Plant-of-the-World-Online: 407086-1

Used in Medicines

Unknown.

Geographical Distribution

United States; Australia

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC79513

Ingredient ID: NPC59551

Ingredient ID: NPC274730

Ingredient ID: NPC264317

Ingredient ID: NPC264310

Ingredient ID: NPC257298

Ingredient ID: NPC236428

Ingredient ID: NPC186397

Ingredient ID: NPC184234

Ingredient ID: NPC169479

Ingredient ID: NPC156654

Ingredient ID: NPC105157

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Oxidoreductase	MAOA	Monoamine oxidase A	P21397	CHEMBL1951

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00701987	Safety, Tolerability, and Preliminary Efficacy Study of ALS-357 in Patients With Cutaneous Metastatic Melanoma	melanoma	Betulinic Acid (NPC264317)	NP level
NCT00346502	Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia)	dysplastic nevus	Betulinic Acid (NPC264317)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA2,CA14
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA2,CA14
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA2,CA14
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA14,CA2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA14,CA2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA14,CA2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA14,CA2
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	MAOA
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOA
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA2
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	MAOA
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	MAOA
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOA
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	MAOA
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MAOA
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MAOA
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NCT00701987
Dysplastic naevus Disease Category: X.Extension Codes Disease ICD-11 Code: XH9035	NCT00346502
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA2
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	MAOA
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA14

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Leptochloa Digitata

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

12 All known Ingredients in Total

12 Ingredients with Acceptable Bioavailablity

7 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Solid tumour/cancer

Breast cancer

Bacterial infection

Carcinosarcoma of uterus

Pheochromocytoma

Adenocarcinoma of pancreas

Cytomegaloviral disease

Substance abuse

Acquired hypomelanotic disorder

Seborrhoeic dermatitis

Rheumatoid arthritis

Heart failure

General pain disorder

Glaucoma

Mood disorder

Essential hypertension

Depression

Skin tag/polyp

Parkinsonism

Low bone mass disorder

Inborn metabolism deficiency

Prostate cancer

Insomnia

Duodenal ulcer

Alzheimer disease

Melanoma

Dysplastic naevus

Serous cystadenoma,borderline malignancy of ovary

Dengue fever, unspecified

Tetralogy of Fallot

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Malignant neoplasms of corpus uteri, unspecified

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Germ cell tumour of testis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities