• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Malus Pumila


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCGTATCGAACGTGCACCGCAGAACGACCCGAGAACCCGTTTCAACGTCGGGGGTCGGCGGGCCTTCGGGCCCGTCGTCCCCTTCGTCCCGGGAGCCCGCTCCGGGGCGTACAAACGAACACCGGCGCGTGCTGGGCCAAGGAATCTGAACGAAAGAGCGCGCTCCCGGAGCCCCGGAAACGGTGCGCGGGCGGGTGCGTCGTCGTCTTCGATATGTCATAACGACTCTCGGTAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCTAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTCTGAACGCAAGTTGCGCCCCAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCCGTTGCCCCCCCCGCGCATCCCTCGGGAGCGTCGGGAGGGGCGGACGATGGCCTCCCGTGCGTCACCCGGCGCGGTTGGCACAAATTCGGGTCCTCGGCTTCGAACGCCACGACAATCGGTGCTCGTCGAACCTGGGTTGCCAGTTGTGCGCTTTCGTCTCGCTTCGAGCGGCCCGCGACGCTCGACGCTCCGCTTCCGCGGAGCTTTCAACGAAACCTGTCCGAACC

Click for details-----ITS1

CCGTATCGAACGTGCACCGCAGAACGACCCGAGAACCCGTTTCAACGTCGGGGGTCGGCGGGCCTTCGGGCCCGTCGTCCCCTTCGTCCCGGGAGCCCGCTCCGGGGCGTACAAACGAACACCGGCGCGTGCTGGGCCAAGGAATCTGAACGAAAGAGCGCGCTCCCGGAGCCCCGGAAACGGTGCGCGGGCGGGTGCGTCGTCGTCTTCGATATGTCATAA

Click for details-----ITS2

GCCGTTGCCCCCCCCGCGCATCCCTCGGGAGCGTCGGGAGGGGCGGACGATGGCCTCCCGTGCGTCACCCGGCGCGGTTGGCACAAATTCGGGTCCTCGGCTTCGAACGCCACGACAATCGGTGCTCGTCGAACCTGGGTTGCCAGTTGTGCGCTTTCGTCTCGCTTCGAGCGGCCCGCGACGCTCGACGCTCCGCTTCCGCGGAGCTTTCAACGAAACCTGTCCGAACC
Taxonomic Information

Plant ID: NPO16230
Plant Latin Name: Malus Pumila
Taxonomy Genus: Malus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 283210
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Italy; China; India

Traditional Medicine System:
Sowa-Rigpa; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Anthelmintic; Antibacterial; Bach; Hypnotic; Refrigerant

Geographical Distribution

India; Italy; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

138 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


82 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

95 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC86412

Ingredient ID: NPC85813

Ingredient ID: NPC84868

Ingredient ID: NPC81015

Ingredient ID: NPC81010

Ingredient ID: NPC69445

Ingredient ID: NPC68517

Ingredient ID: NPC66352

Ingredient ID: NPC63859

Ingredient ID: NPC62045

Ingredient ID: NPC61449

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC58629

Ingredient ID: NPC58190

Ingredient ID: NPC55412

Ingredient ID: NPC491218

Ingredient ID: NPC490435

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490411

Ingredient ID: NPC490383

Ingredient ID: NPC490363

Ingredient ID: NPC490359

Ingredient ID: NPC490344

Ingredient ID: NPC490242

Ingredient ID: NPC489907

Ingredient ID: NPC489898

Ingredient ID: NPC489877

Ingredient ID: NPC48623

Ingredient ID: NPC424

Ingredient ID: NPC34908

Ingredient ID: NPC330717

Ingredient ID: NPC328447

Ingredient ID: NPC32306

Ingredient ID: NPC317291

Ingredient ID: NPC317120

Ingredient ID: NPC315603

Ingredient ID: NPC313955

Ingredient ID: NPC313179

Ingredient ID: NPC312800

Ingredient ID: NPC301696

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC289758

Ingredient ID: NPC28657

Ingredient ID: NPC285322

Ingredient ID: NPC281686

Ingredient ID: NPC281131

Ingredient ID: NPC279406

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC272614

Ingredient ID: NPC271732

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26657

Ingredient ID: NPC2660

Ingredient ID: NPC265607

Ingredient ID: NPC265319

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC259182

Ingredient ID: NPC257963

Ingredient ID: NPC254696

Ingredient ID: NPC252553

Ingredient ID: NPC246679

Ingredient ID: NPC246558

Ingredient ID: NPC245561

Ingredient ID: NPC242895

Ingredient ID: NPC242580

Ingredient ID: NPC242203

Ingredient ID: NPC237812

Ingredient ID: NPC236202

Ingredient ID: NPC229415

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC219246

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC203076

Ingredient ID: NPC202742

Ingredient ID: NPC201844

Ingredient ID: NPC200561

Ingredient ID: NPC199072

Ingredient ID: NPC197087

Ingredient ID: NPC192034

Ingredient ID: NPC190501

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC181350

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC174246

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC164487

Ingredient ID: NPC160512

Ingredient ID: NPC159451

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC1507

Ingredient ID: NPC147983

Ingredient ID: NPC139658

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC122245

Ingredient ID: NPC119368

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC11311

Ingredient ID: NPC112941

Ingredient ID: NPC112890

Ingredient ID: NPC111897

Ingredient ID: NPC110899

Ingredient ID: NPC108811

Ingredient ID: NPC1042