• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Morus Bombycis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

ACAACACCCAGGGGTGACCCCAACCCCTGACGCTGAGTGTGTGCAGCCCTGCCTTGCGCCCTCAGCATAAAACGAACCCAGGCGCGGAACGGGTCAAGGAATCATAACGAAAGGAGCTCTTGCCGTGGCCCCGGGGACGGTGATCGCCGCAGCAGCTGTGTTGTGCTAGGTTAAGTCTAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO16194
Plant Latin Name: Morus Bombycis
Taxonomy Genus: Morus
Taxonomy Family: Moraceae

Plant External Links:

NCBI TaxonomyDB: 66393
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM


Medicinal Functions:

Diuretic; Pectoral

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

83 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


53 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

62 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98750

Ingredient ID: NPC96565

Ingredient ID: NPC96034

Ingredient ID: NPC85813

Ingredient ID: NPC85812

Ingredient ID: NPC85491

Ingredient ID: NPC81010

Ingredient ID: NPC8087

Ingredient ID: NPC80471

Ingredient ID: NPC76726

Ingredient ID: NPC7630

Ingredient ID: NPC75435

Ingredient ID: NPC72158

Ingredient ID: NPC70756

Ingredient ID: NPC70574

Ingredient ID: NPC6984

Ingredient ID: NPC69669

Ingredient ID: NPC66655

Ingredient ID: NPC62765

Ingredient ID: NPC61477

Ingredient ID: NPC5326

Ingredient ID: NPC32977

Ingredient ID: NPC309419

Ingredient ID: NPC306462

Ingredient ID: NPC302857

Ingredient ID: NPC296651

Ingredient ID: NPC291066

Ingredient ID: NPC290319

Ingredient ID: NPC290106

Ingredient ID: NPC289758

Ingredient ID: NPC285014

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC274121

Ingredient ID: NPC268221

Ingredient ID: NPC261619

Ingredient ID: NPC255662

Ingredient ID: NPC255535

Ingredient ID: NPC249912

Ingredient ID: NPC247553

Ingredient ID: NPC225710

Ingredient ID: NPC223697

Ingredient ID: NPC219876

Ingredient ID: NPC216630

Ingredient ID: NPC216330

Ingredient ID: NPC213935

Ingredient ID: NPC21209

Ingredient ID: NPC20791

Ingredient ID: NPC206800

Ingredient ID: NPC202292

Ingredient ID: NPC193577

Ingredient ID: NPC189087

Ingredient ID: NPC187770

Ingredient ID: NPC18188

Ingredient ID: NPC179950

Ingredient ID: NPC179271

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC169749

Ingredient ID: NPC169471

Ingredient ID: NPC167976

Ingredient ID: NPC16728

Ingredient ID: NPC162612

Ingredient ID: NPC150680

Ingredient ID: NPC142703

Ingredient ID: NPC142415

Ingredient ID: NPC139617

Ingredient ID: NPC137949

Ingredient ID: NPC137554

Ingredient ID: NPC133671

Ingredient ID: NPC130683

Ingredient ID: NPC126664

Ingredient ID: NPC126029

Ingredient ID: NPC12440

Ingredient ID: NPC119107

Ingredient ID: NPC116775

Ingredient ID: NPC113212

Ingredient ID: NPC112890

Ingredient ID: NPC112889

Ingredient ID: NPC110882

Ingredient ID: NPC110373

Ingredient ID: NPC101991