• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Desmodium Canadense


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GTGAACCTGCGGAAGGATCATTGTCGATGGCTCACAATCAGTTTGACCGGCGAACACGTTTATCTGACCCGCGGGGGATGGCACGATCTCGTCATTCCCCCACCTCCCCGGGATGCGGCCTCGCACGGCGTGGCTTCCTCCCGGAGATCACAAACCCCGGCGCCTCGTGCGCCAAGGAATCCAAAATTGTTCAGTGCGGCCCCGGGGGAGTTGGAGACAACGTCCCGCGAGTCCCGTCACGACGCACGAAAAAGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO16182
Plant Latin Name: Desmodium Canadense
Taxonomy Genus: Desmodium
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 932098
Plant-of-the-World-Online: 1051889-2

Used in Medicines

Unknown.

Geographical Distribution

Canada; United States

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

23 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


16 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC80710

Ingredient ID: NPC78263

Ingredient ID: NPC46436

Ingredient ID: NPC35446

Ingredient ID: NPC304543

Ingredient ID: NPC294409

Ingredient ID: NPC284264

Ingredient ID: NPC279668

Ingredient ID: NPC270456

Ingredient ID: NPC262359

Ingredient ID: NPC245889

Ingredient ID: NPC243728

Ingredient ID: NPC233752

Ingredient ID: NPC228024

Ingredient ID: NPC226333

Ingredient ID: NPC225434

Ingredient ID: NPC22152

Ingredient ID: NPC192638

Ingredient ID: NPC182428

Ingredient ID: NPC181465

Ingredient ID: NPC143427

Ingredient ID: NPC135350

Ingredient ID: NPC112368