• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Conocarpus Erectus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGGCACCTGCAAAGCAGAACGACCCGCGAACGGTTTTTTCGACACCTGGGGCATCGAGGGGCGTCTAGTCGCTTGCTCGGTATCCCAACGCTTCGGATGCTGAGGGTGCAACCCACCTTCGGCCGATGGAGCTTCAAACAAACCCCGGCGCGCAAAGCGCCAAGGTACTCCAACAAGAGAGCATGCACTCGTAGCCGCGCGCTCGAGTTGCTGTTCAATGCCATAAAATCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCTTTGGCTGAGGGCACGTCTGCCTGGGTGTCACACATCGTGTTGCCTCCAAACCCTTCGCCCCTCAAATGCTGTGGTGGCGATTCGGATGCGGAAGTTGGCCTCCCGTGACCACGAGCCACGGATGGCCCAAATGCATGCTAGGGAAGAGAAGTGCCACGGCATTCGGTGGTTGGTCTAGCCCCAAAACAATGCCGGTGGTGGCTACGTGTGTCCCTAACATACGACCCTTATCGTTAACCGA

Click for details-----ITS1

TCGGCACCTGCAAAGCAGAACGACCCGCGAACGGTTTTTTCGACACCTGGGGCATCGAGGGGCGTCTAGTCGCTTGCTCGGTATCCCAACGCTTCGGATGCTGAGGGTGCAACCCACCTTCGGCCGATGGAGCTTCAAACAAACCCCGGCGCGCAAAGCGCCAAGGTACTCCAACAAGAGAGCATGCACTCGTAGCCGCGCGCTCGAGTTGCTGTTCAATGCCATAAAATCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO16158
Plant Latin Name: Conocarpus Erectus
Taxonomy Genus: Conocarpus
Taxonomy Family: Combretaceae

Plant External Links:

NCBI TaxonomyDB: 134917
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil

Traditional Medicine System:

Geographical Distribution

Brazil

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

31 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


27 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97727

Ingredient ID: NPC84454

Ingredient ID: NPC76336

Ingredient ID: NPC71004

Ingredient ID: NPC6984

Ingredient ID: NPC69667

Ingredient ID: NPC67599

Ingredient ID: NPC45483

Ingredient ID: NPC41500

Ingredient ID: NPC32421

Ingredient ID: NPC32163

Ingredient ID: NPC31584

Ingredient ID: NPC27526

Ingredient ID: NPC262047

Ingredient ID: NPC252655

Ingredient ID: NPC235224

Ingredient ID: NPC230007

Ingredient ID: NPC228069

Ingredient ID: NPC213312

Ingredient ID: NPC195172

Ingredient ID: NPC195170

Ingredient ID: NPC176740

Ingredient ID: NPC175492

Ingredient ID: NPC159115

Ingredient ID: NPC15692

Ingredient ID: NPC149184

Ingredient ID: NPC145538

Ingredient ID: NPC142415

Ingredient ID: NPC127074

Ingredient ID: NPC118843

Ingredient ID: NPC117727