• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Urtica Cannabina


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGAACCTGCTTCATGCAAAATGACCCGCGAATAAGTTCTTACGTTTTGGGGCAAGGATGGCTAGTACTCTCGACCATTCTTGTCTTGCTTCTAACAACCAAAGGCGCGGGATGCGCCAAGGAAAATCCAAACGAGTTTGACTCTTGCCTCGGTGCATTGCATCGTGGCAGCGAGTGTATTCGATAAGTCGTAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACGTGGTGTGAATTGCAGGATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCACCGTTGCCCTCCAAACCTCCGCAGTCCTTTAGTGGGATTGTTGAGATGTGCGGGGGTCGTAAAGTGGCTTCCCGTCGGCTTTGTCCTGCGGTTGGCCTAAAAATGTATCCCTAGTCGCGGTGCGCGCGGCATTCGGTGGTCATCGATAGATTTCGTTACCCCGCCGTGCGCTCCCGTGTTGCGAAGGATGTCACCAGCAAACCCGATGTCTCGCTCTGTGAAGAGCGTAGCTTACAACGCGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO16066
Plant Latin Name: Urtica Cannabina
Taxonomy Genus: Urtica
Taxonomy Family: Urticaceae

Plant External Links:

NCBI TaxonomyDB: 546995
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

4 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC84226

Ingredient ID: NPC7231

Ingredient ID: NPC61691

Ingredient ID: NPC47950

Ingredient ID: NPC323956

Ingredient ID: NPC315672

Ingredient ID: NPC291428

Ingredient ID: NPC288714

Ingredient ID: NPC26316

Ingredient ID: NPC229401

Ingredient ID: NPC221049

Ingredient ID: NPC18950

Ingredient ID: NPC159900

Ingredient ID: NPC136426

Ingredient ID: NPC13402

Ingredient ID: NPC115382

Ingredient ID: NPC100179