• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Justicia Procumbens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTTCGTAGGTGACCTGCGGAAGGATCATTGTCGTAACCTGCGAGGTAGACCGCGAACACGTGCTAAACGTCGCCGCGTGCACGGGGAGGGAGGACGTGTCCCCCCGCATCCGTGCTCGCGGCACCACCCCGTCGGCGCGTGCGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCGAAAACGAAGCGCCCTCCACCGCTCGAGCACCGTCCGCGGAGCGCTTCGAGCGGATGGAAGGGTACGCCTCACGTGAGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCTCCCCCCGCTCCCCATGGAGTGGACGGGGAAGGGGCGGAGAATGGCCTCCCGTGTGCACCGTCGCGCGGCCGGCCCAAATGCGATCCCCCGGCGGCGCCAGTCGCGACCAGTGGTGATTGAAACGTCAACTCGCGTACTGACTGTCGTGCGTAGCGGCGTCGTCCGGAATGGGCATCACCGCGACCCAACCGGCGCCTCGGCGCTTCCGA

Click for details-----ITS1

TTTCGTAGGTGACCTGCGGAAGGATCATTGTCGTAACCTGCGAGGTAGACCGCGAACACGTGCTAAACGTCGCCGCGTGCACGGGGAGGGAGGACGTGTCCCCCCGCATCCGTGCTCGCGGCACCACCCCGTCGGCGCGTGCGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCGAAAACGAAGCGCCCTCCACCGCTCGAGCACCGTCCGCGGAGCGCTTCGAGCGGATGGAAGGGTACGCCTCACGTGAGAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCTCCCCCCGCTCCCCATGGAGTGGACGGGGAAGGGGCGGAGAATGGCCTCCCGTGTGCACCGTCGCGCGGCCGGCCCAAATGCGATCCCCCGGCGACGCCAGTCGCGACCAGTGGTGATTGAAACGTCAACTCGCGTACTGACTGTCGTGCGTAGCGGCGTCGTCCGGAATGGGCATCACCGCGACCCAACCAGCGCCTCGGCGCTTCCGACCGC
Taxonomic Information

Plant ID: NPO16045
Plant Latin Name: Justicia Procumbens
Taxonomy Genus: Justicia
Taxonomy Family: Acanthaceae

Plant External Links:

NCBI TaxonomyDB: 859317
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Vietnam; India

Traditional Medicine System:


Medicinal Functions:

Antiphlogistic; Depurative; Diaphoretic; Diuretic; Febrifuge; Laxative; Ophthalmic; Skin

Geographical Distribution

Vietnam; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

24 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


20 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

13 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88967

Ingredient ID: NPC78944

Ingredient ID: NPC65785

Ingredient ID: NPC65784

Ingredient ID: NPC5469

Ingredient ID: NPC50922

Ingredient ID: NPC49545

Ingredient ID: NPC35266

Ingredient ID: NPC313063

Ingredient ID: NPC260358

Ingredient ID: NPC24193

Ingredient ID: NPC239113

Ingredient ID: NPC238937

Ingredient ID: NPC22130

Ingredient ID: NPC221158

Ingredient ID: NPC214047

Ingredient ID: NPC198796

Ingredient ID: NPC19600

Ingredient ID: NPC185654

Ingredient ID: NPC184624

Ingredient ID: NPC167045

Ingredient ID: NPC155827

Ingredient ID: NPC15212

Ingredient ID: NPC149370