• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Scutellaria Barbata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCGAAAGCAGACCCGCGAACACGTGTCTTCACGACAAAAACAACGCCCGCGAGGCCGGCGCGAGAGCGTCGCAACCCGCGGGCTAACGAACCCGGGCGCGGAACGCGCCAAGGAAAACCGAAACGAAGCGTCCCCGCCCCGTGCGTCCCGTCCGCGGATCGCGCGCGGGGTGGCCGGACGTCGATCGAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCCGCACGCATCGCCTCGAGCGACGCCTATGTCGGGGGGCGGAGATTGGCCTCCCGTGCGCCCCGGTGCGCGGCCGGCCCAAATGCGATCCCCCGGCGACGCACGCCCCGACAAGTGGTGGTTGAGCCTTCAACTCGCGTGCTGTCGGGCGCCAAGGCGTCGTCCGTTCGGGAGAAACACATCGATCGATGTTGGACCCAACGGCCCTTAATAGAGCCATCGA

Click for details-----ITS1

TCGAAACCTGCGAAAGCAGACCCGCGAACACGTGTCTTCACGACAAAAACAACGCCCGCGAGGCCGGCGCGAGAGCGTCGCAACCCGCGGGCTAACGAACCCGGGCGCGGAACGCGCCAAGGAAAACCGAAACGAAGCGTCCCCGCCCCGTGCGTCCCGTCCGCGGATCGCGCGCGGGGTGGCCGGACGTCGATCGAATGTCATAA

Click for details-----ITS2

ATCGCGTCGCTCCCCGCACGCATCGCCTCGAGCGACGCCTATGTCGGGGGGCGGAGATTGGCCTCCCGTGCGCCCCGGTGCGCGGCCGGCCCAAATGCGATCCCCCGGCGACGCACGCCCCGACAAGTGGTGGTTGAGCCTTCAACTCGCGTGCTGTCGGGCGCCAAGGCGTCGTCCGTTCGGGAGAAACACATCGATCGATGTTGGACCCAACGGCCCTTAATAGAGCCATCGA
Taxonomic Information

Plant ID: NPO16039
Plant Latin Name: Scutellaria Barbata
Taxonomy Genus: Scutellaria
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 396367
Plant-of-the-World-Online: 458159-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Depurative; Diuretic; Febrifuge

Geographical Distribution

Bangladesh; Myanmar; South Africa; Nepal; India; Vietnam; China; Laos; Japan; Taiwan; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

295 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


175 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

158 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99480

Ingredient ID: NPC99350

Ingredient ID: NPC97982

Ingredient ID: NPC95969

Ingredient ID: NPC95675

Ingredient ID: NPC93726

Ingredient ID: NPC91574

Ingredient ID: NPC91125

Ingredient ID: NPC89088

Ingredient ID: NPC88072

Ingredient ID: NPC86941

Ingredient ID: NPC85473

Ingredient ID: NPC84793

Ingredient ID: NPC84030

Ingredient ID: NPC8339

Ingredient ID: NPC83283

Ingredient ID: NPC81010

Ingredient ID: NPC79943

Ingredient ID: NPC79672

Ingredient ID: NPC79056

Ingredient ID: NPC78500

Ingredient ID: NPC77225

Ingredient ID: NPC76145

Ingredient ID: NPC75204

Ingredient ID: NPC7491

Ingredient ID: NPC73528

Ingredient ID: NPC7314

Ingredient ID: NPC7057

Ingredient ID: NPC6984

Ingredient ID: NPC68889

Ingredient ID: NPC68150

Ingredient ID: NPC66681

Ingredient ID: NPC66624

Ingredient ID: NPC65625

Ingredient ID: NPC65517

Ingredient ID: NPC65003

Ingredient ID: NPC63041

Ingredient ID: NPC62367

Ingredient ID: NPC60556

Ingredient ID: NPC59570

Ingredient ID: NPC57877

Ingredient ID: NPC56505

Ingredient ID: NPC54383

Ingredient ID: NPC54264

Ingredient ID: NPC52230

Ingredient ID: NPC51257

Ingredient ID: NPC50898

Ingredient ID: NPC49151

Ingredient ID: NPC48042

Ingredient ID: NPC477912

Ingredient ID: NPC477911

Ingredient ID: NPC477910

Ingredient ID: NPC477909

Ingredient ID: NPC477908

Ingredient ID: NPC477907

Ingredient ID: NPC477906

Ingredient ID: NPC477905

Ingredient ID: NPC477904

Ingredient ID: NPC477903

Ingredient ID: NPC477902

Ingredient ID: NPC477901

Ingredient ID: NPC477900

Ingredient ID: NPC477899

Ingredient ID: NPC472556

Ingredient ID: NPC472555

Ingredient ID: NPC472554

Ingredient ID: NPC472553

Ingredient ID: NPC472552

Ingredient ID: NPC472551

Ingredient ID: NPC472550

Ingredient ID: NPC472549

Ingredient ID: NPC472548

Ingredient ID: NPC472547

Ingredient ID: NPC472546

Ingredient ID: NPC472545

Ingredient ID: NPC46248

Ingredient ID: NPC45270

Ingredient ID: NPC45107

Ingredient ID: NPC44751

Ingredient ID: NPC44328

Ingredient ID: NPC43212

Ingredient ID: NPC43211

Ingredient ID: NPC42678

Ingredient ID: NPC42471

Ingredient ID: NPC41348

Ingredient ID: NPC41004

Ingredient ID: NPC40249

Ingredient ID: NPC39549

Ingredient ID: NPC39360

Ingredient ID: NPC392

Ingredient ID: NPC39131

Ingredient ID: NPC38751

Ingredient ID: NPC37871

Ingredient ID: NPC36395

Ingredient ID: NPC3492

Ingredient ID: NPC34440

Ingredient ID: NPC33489

Ingredient ID: NPC33415

Ingredient ID: NPC330029

Ingredient ID: NPC32977

Ingredient ID: NPC329483

Ingredient ID: NPC327838

Ingredient ID: NPC32441

Ingredient ID: NPC32279

Ingredient ID: NPC32222

Ingredient ID: NPC321339

Ingredient ID: NPC319128

Ingredient ID: NPC317437

Ingredient ID: NPC311485

Ingredient ID: NPC310820

Ingredient ID: NPC31048

Ingredient ID: NPC309182

Ingredient ID: NPC307011

Ingredient ID: NPC306990

Ingredient ID: NPC306821

Ingredient ID: NPC305151

Ingredient ID: NPC30433

Ingredient ID: NPC30430

Ingredient ID: NPC304208

Ingredient ID: NPC304179

Ingredient ID: NPC302857

Ingredient ID: NPC301738

Ingredient ID: NPC301585

Ingredient ID: NPC301323

Ingredient ID: NPC297844

Ingredient ID: NPC297527

Ingredient ID: NPC297422

Ingredient ID: NPC296197

Ingredient ID: NPC295777

Ingredient ID: NPC294136

Ingredient ID: NPC29353

Ingredient ID: NPC292792

Ingredient ID: NPC292293

Ingredient ID: NPC292092

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC289120

Ingredient ID: NPC288069

Ingredient ID: NPC287731

Ingredient ID: NPC287550

Ingredient ID: NPC287349

Ingredient ID: NPC286774

Ingredient ID: NPC285186

Ingredient ID: NPC282169

Ingredient ID: NPC281448

Ingredient ID: NPC280869

Ingredient ID: NPC279865

Ingredient ID: NPC279364

Ingredient ID: NPC279121

Ingredient ID: NPC2785

Ingredient ID: NPC275463

Ingredient ID: NPC275462

Ingredient ID: NPC274584

Ingredient ID: NPC273072

Ingredient ID: NPC272902

Ingredient ID: NPC271321

Ingredient ID: NPC26960

Ingredient ID: NPC269416

Ingredient ID: NPC26906

Ingredient ID: NPC26881

Ingredient ID: NPC268291

Ingredient ID: NPC264674

Ingredient ID: NPC260000

Ingredient ID: NPC259512

Ingredient ID: NPC259465

Ingredient ID: NPC259134

Ingredient ID: NPC257124

Ingredient ID: NPC256803

Ingredient ID: NPC25676

Ingredient ID: NPC255042

Ingredient ID: NPC254684

Ingredient ID: NPC252230

Ingredient ID: NPC250828

Ingredient ID: NPC249801

Ingredient ID: NPC248881

Ingredient ID: NPC246679

Ingredient ID: NPC246543

Ingredient ID: NPC246469

Ingredient ID: NPC244847

Ingredient ID: NPC244210

Ingredient ID: NPC24294

Ingredient ID: NPC241721

Ingredient ID: NPC241498

Ingredient ID: NPC239312

Ingredient ID: NPC239037

Ingredient ID: NPC237951

Ingredient ID: NPC237435

Ingredient ID: NPC237307

Ingredient ID: NPC237002

Ingredient ID: NPC23584

Ingredient ID: NPC235364

Ingredient ID: NPC235165

Ingredient ID: NPC233533

Ingredient ID: NPC233428

Ingredient ID: NPC231738

Ingredient ID: NPC228331

Ingredient ID: NPC228074

Ingredient ID: NPC2251

Ingredient ID: NPC224985

Ingredient ID: NPC224491

Ingredient ID: NPC223468

Ingredient ID: NPC222830

Ingredient ID: NPC220061

Ingredient ID: NPC219913

Ingredient ID: NPC216900

Ingredient ID: NPC216858

Ingredient ID: NPC216714

Ingredient ID: NPC216630

Ingredient ID: NPC216428

Ingredient ID: NPC214584

Ingredient ID: NPC213216

Ingredient ID: NPC211920

Ingredient ID: NPC210831

Ingredient ID: NPC210003

Ingredient ID: NPC209275

Ingredient ID: NPC208075

Ingredient ID: NPC20742

Ingredient ID: NPC206800

Ingredient ID: NPC206343

Ingredient ID: NPC20505

Ingredient ID: NPC204268

Ingredient ID: NPC204120

Ingredient ID: NPC202691

Ingredient ID: NPC197977

Ingredient ID: NPC192872

Ingredient ID: NPC191498

Ingredient ID: NPC189142

Ingredient ID: NPC188243

Ingredient ID: NPC187679

Ingredient ID: NPC187061

Ingredient ID: NPC184049

Ingredient ID: NPC183270

Ingredient ID: NPC182840

Ingredient ID: NPC182102

Ingredient ID: NPC180871

Ingredient ID: NPC180840

Ingredient ID: NPC18077

Ingredient ID: NPC180058

Ingredient ID: NPC176309

Ingredient ID: NPC175987

Ingredient ID: NPC175733

Ingredient ID: NPC174919

Ingredient ID: NPC174490

Ingredient ID: NPC173996

Ingredient ID: NPC173637

Ingredient ID: NPC171280

Ingredient ID: NPC167976

Ingredient ID: NPC164338

Ingredient ID: NPC162822

Ingredient ID: NPC16157

Ingredient ID: NPC161555

Ingredient ID: NPC158537

Ingredient ID: NPC156654

Ingredient ID: NPC153958

Ingredient ID: NPC152538

Ingredient ID: NPC152280

Ingredient ID: NPC150643

Ingredient ID: NPC148860

Ingredient ID: NPC148216

Ingredient ID: NPC147502

Ingredient ID: NPC147343

Ingredient ID: NPC145708

Ingredient ID: NPC145379

Ingredient ID: NPC145353

Ingredient ID: NPC143639

Ingredient ID: NPC142860

Ingredient ID: NPC141078

Ingredient ID: NPC139546

Ingredient ID: NPC139131

Ingredient ID: NPC138630

Ingredient ID: NPC138347

Ingredient ID: NPC13789

Ingredient ID: NPC137816

Ingredient ID: NPC135602

Ingredient ID: NPC135077

Ingredient ID: NPC134370

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC131624

Ingredient ID: NPC131482

Ingredient ID: NPC130230

Ingredient ID: NPC125144

Ingredient ID: NPC124029

Ingredient ID: NPC122962

Ingredient ID: NPC121549

Ingredient ID: NPC11956

Ingredient ID: NPC117493

Ingredient ID: NPC112320

Ingredient ID: NPC111888

Ingredient ID: NPC109813

Ingredient ID: NPC106250

Ingredient ID: NPC105509

Ingredient ID: NPC101285

Ingredient ID: NPC100570