• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Niphogeton Ternata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAATAGCAGAACGACCCGCTAACACGTCAACAATTTGGGCAAGCGTCGGGGGGCCTCGGTCTCCTGTCTGCGAATCCCTGGTAGGTGCCCACTCTCGGGTGGCCACTGGCCTGCAAAATCATTCGGGCGCGGAATGCGCCAAGGACCTTAAAACTGAATTGTACGTCCGTATCCCGTTAGCGGGCACCGGCGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCTTGCCCACAAACCACCCACACCTGAGAAGTTGTGCCGGTTTGGGGCGGAAACTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAACGAGTCTCCGGCGACGGACGTCGCGACATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGCAAATCCTCGTCATTTTAGCGAGCTCCAGGACCCTTAGGCAGCACACACTCTGTGCGCTTCGA

Click for details-----ITS1

TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACAATTTGGGCAAGCGTCGGGGGGCCTCGGTCTCCTGTCTGCGAATCCCTGGTAGGTGCCCACTCTCGGGTGGCCACTGGCCTGCAAAATCATTCGGGCGCGGAATGCGCCAAGGACCTTAAAACTGAATTGTACGTCCGTATCCCGTTAGCGGGCACCGGCGTCATTCCAAAACACAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO16027
Plant Latin Name: Niphogeton Ternata
Taxonomy Genus: Niphogeton
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 681593
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

40 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC92272

Ingredient ID: NPC90515

Ingredient ID: NPC89591

Ingredient ID: NPC88445

Ingredient ID: NPC83798

Ingredient ID: NPC82701

Ingredient ID: NPC60175

Ingredient ID: NPC57526

Ingredient ID: NPC49168

Ingredient ID: NPC46495

Ingredient ID: NPC34480

Ingredient ID: NPC33320

Ingredient ID: NPC290598

Ingredient ID: NPC290495

Ingredient ID: NPC27765

Ingredient ID: NPC273982

Ingredient ID: NPC262925

Ingredient ID: NPC260265

Ingredient ID: NPC257783

Ingredient ID: NPC254509

Ingredient ID: NPC254178

Ingredient ID: NPC243509

Ingredient ID: NPC240681

Ingredient ID: NPC239270

Ingredient ID: NPC238954

Ingredient ID: NPC234536

Ingredient ID: NPC213264

Ingredient ID: NPC195334

Ingredient ID: NPC190056

Ingredient ID: NPC18439

Ingredient ID: NPC174423

Ingredient ID: NPC169

Ingredient ID: NPC163533

Ingredient ID: NPC159362

Ingredient ID: NPC155668

Ingredient ID: NPC155543

Ingredient ID: NPC149210

Ingredient ID: NPC142969

Ingredient ID: NPC133429

Ingredient ID: NPC121744

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 2 CYP2A13 Cytochrome P450 2A13 Q16696 CHEMBL3542436
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level18
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT03512756 A Randomized Phase 2/3 Multi-Center Study of SM-88 in Patients With Metastatic Pancreatic Cancer pancreatic carcinoma Methoxsalen (NPC33320) NP level
NCT00221026 Safety and Efficacy of Extracorporeal Photoimmune Therapy With UVADEX for the Treatment of Crohn's Disease Crohn's disease Methoxsalen (NPC33320) NP level
NCT00282503 Extracorporeal Photoimmune Therapy With UVADEX for the Treatment of Acute Graft Versus-Host Disease acute graft vs. host disease Methoxsalen (NPC33320) NP level
NCT00030589 Chemotherapy and Photodynamic Therapy in Treating Patients With Cutaneous T-Cell Lymphoma lymphoma Methoxsalen (NPC33320) NP level
NCT00056056 Ultraviolet Light Therapy Using Methoxsalen With or Without Bexarotene in Treating Patients With Mycosis Fungoides lymphoma Methoxsalen (NPC33320) NP level
NCT00221000 Safety and Efficacy of Extracorporeal Photoimmune Therapy With UVADEX for the Treatment of Rheumatoid Arthritis rheumatoid arthritis Methoxsalen (NPC33320) NP level
NCT00930566 Extracorporal Photopheresis Pilot Study lymphoid neoplasm Methoxsalen (NPC33320) NP level
NCT01686594 PUVA Maintenance Therapy in Mycosis Fungoides mycosis fungoides Methoxsalen (NPC33320) NP level
NCT00639717 Addition of Etanercept and Extracorporeal Photopheresis (ECP) to Standard Graft-Versus-Host Disease (GVHD) Prophylaxis in Stem Cell Transplant graft versus host disease Methoxsalen (NPC33320) NP level
NCT03778996 SM-88 Maintenance Therapy for Advanced Ewing's Sarcoma and as Salvage Therapy for Sarcoma Ewing sarcoma Methoxsalen (NPC33320) NP level
NCT02524847 Methoxsalen and Extracorporeal Photopheresis (ECP) for the Treatment of Pediatric Participants With Steroid Refractory Acute Graft Versus Host Disease acute graft vs. host disease Methoxsalen (NPC33320) NP level
NCT04291261 Extracorporal Photopheresis With UVADEX Plus Standard Steroid Treatment for High Risk Acute Graft-versus-host Disease acute graft vs. host disease Methoxsalen (NPC33320) NP level
NCT00054613 Safety and Efficacy Study of Photopheresis Plus Standard Therapy to Treat Chronic Graft-versus-Host Disease graft versus host disease Methoxsalen (NPC33320) NP level
NCT00056355 Extracorporeal Photopheresis to Maintain Symptoms Remission During Steroid Withdrawal in Patients With Steroid-Dependent Crohn's Disease Crohn's disease Methoxsalen (NPC33320) NP level
NCT00054600 Safety and Efficacy Study of Photopheresis With UVADEX to Prevent Graft-versus-Host Disease graft versus host disease Methoxsalen (NPC33320) NP level
NCT04986605 Extracorporeal Photopheresis in Early Diffuse Cutaneous Systemic Sclerosis diffuse scleroderma Methoxsalen (NPC33320) NP level
NCT03563040 Study of Photopheresis in the Treatment of Erythrodermic MF and SS Sezary's disease;mycosis fungoides Methoxsalen (NPC33320) NP level
NCT00004359 Phase II Pilot Study of Extracorporeal Phototherapy for Epidermolysis Bullosa Acquisita epidermolysis bullosa acquisita Methoxsalen (NPC33320) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Graft-versus-host disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4B24
 NCT02524847,NCT04291261,NCT00054600,NCT00639717,NCT00282503,NCT00054613
Mycosis fungoides
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B01
 CYP2A6
 NCT03563040,NCT01686594
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 NCT00056355,NCT00221026
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 NCT00056056,NCT00030589
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CYP1A2,CYP2A13
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CYP1B1,ACHE
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CYP1A1,ACHE
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 CYP1A1,ACHE
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP1B1,ACHE
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CYP2A6,CYP2A13
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A1,CYP1A2
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 ACHE
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 ACHE
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 ACHE
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 CYP2A6
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 ACHE
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ACHE
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Sezary syndrome
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH8HN3
 NCT03563040
Malignant neoplasm of pancreas, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.Z
 NCT03512756
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 NCT00221000
Neoplasms of haematopoietic or lymphoid tissues, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B3Z
 NCT00930566
Ewing sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B52
 NCT03778996
Epidermolysis bullosa acquisita
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EB43
 NCT00004359
NA
Disease Category: NA
Disease ICD-11 Code: NA
 NCT04986605
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CYP2A13
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 ACHE
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 CYP2A13
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 ACHE
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 ACHE
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 ACHE
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CYP1A1
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 ACHE
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 ACHE
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP1A2
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CYP1A1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CYP1B1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 ACHE
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CYP1A1
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CYP1B1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 ACHE
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group