CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Alangium Chinense

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAGAGCAGAACGACCCGCGAACTAGTTTCTTGACACCGTGCGCGGCGGGTGCGCGCCTCGCGTGTGCCGGCCGTGCCGAAAAAACGAACCCCGGCGCGGACCGCGCCAAGGATCACCGAAAGGAAAAACAAGAGCAGCGCCCCCCGGGGACCCCGGGGAGCGGCGGCTTCTTCCACTAGTTAAAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCTCGCAACGCGTCGCCACCCCCTCCCGCCTAGCCAAGCGCTGCGGGCTCCGGGGGGCGGATGGTGGCCTCCCGTGCGCGGGAAACGCGCGCGGTTGGCCTAAAAACGAGTCCACGACGACGGACGTCACGACAAGTGGTGGTTGAGAGACCCTCGGTCGCGTCGCGTCGTGCGCGCTGCCGTCGTCGACGGCTGGCTCAAGTGACCCCTGCGCACTGGCACCCCTGTGCCATGTGCCTCGACCGCGACTCTTCTAGTGCAGACGCAACGTCCCAGC

Click for details-----ITS1

TTTGAAGTAAAAAGTGTAAAAAGTTTCCTAGTGAACTGCGGAGAACATTGTCGAACCTGCAAGGAGACGACCCGCGACTCGTTTCTGACACCGCGCCGGCCGGCGCTCGCCCGCGTGCGCCTGCCGTGCCGAAAAACGAACCCCGGCGCGGACCGCGCCAAGGATCCCGAAAGGAAAACCAAGACCGCACCCCCGGGAACCCCGGGGAGCGGCGGCTTCTTCCCTATTCAAAA

Click for details-----ITS2

AACGCGTCGCCACCCCCTCCCGCCTAGCCAAGCGCTGCGGGCTCCGGGGGGCGGATGGTGGCCTCCCGTGCGCGGGAAACGCGCGCGGTTGGCCTAAAAACGAGTCCACGACGACGGACGTCACGACAAGTGGTGGTTGAGAGACCCTCGGTCGCGTCGCGTCGTGCGCGCTGCCGTCGTCGACGGCTGGCTCAAGTGACCCCTGCGCACTGGCACCCCTGTGCCATGTGCCTCGACCGCGACTCTTCTAGTGCAGACGCAACGTCCCAGC

Taxonomic Information

Plant ID: NPO15986
Plant Latin Name: Alangium Chinense
Taxonomy Genus: Alangium
Taxonomy Family: Cornaceae

Plant External Links:

NCBI TaxonomyDB: 16897
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Kenya; Tanzania; Rwanda

Traditional Medicine System:

Medicinal Functions:

Blood tonic; Carminative; Contraceptive

Geographical Distribution

Kenya; Tanzania; Rwanda

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

21 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

21 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC78795

Ingredient ID: NPC59779

Ingredient ID: NPC59459

Ingredient ID: NPC58865

Ingredient ID: NPC471179

Ingredient ID: NPC471178

Ingredient ID: NPC471177

Ingredient ID: NPC41847

Ingredient ID: NPC302564

Ingredient ID: NPC273683

Ingredient ID: NPC253488

Ingredient ID: NPC183779

Ingredient ID: NPC181768

Ingredient ID: NPC168911

Ingredient ID: NPC168471

Ingredient ID: NPC166424

Ingredient ID: NPC151537

Ingredient ID: NPC135730

Ingredient ID: NPC133461

Ingredient ID: NPC124602

Ingredient ID: NPC124542

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Nicotinic acetylcholine receptor	CHRNA7	Neuronal acetylcholine receptor protein alpha-7 subunit	P36544	CHEMBL2492

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	CHRFAM7A,CHRNA7,CHRNA4
Corneal disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A76-9A78	CHRNA4,CHRNA7,CHRFAM7A
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	CHRNA7,CHRNA4,CHRFAM7A
Nicotine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4A	CHRNA4,CHRFAM7A,CHRNA7
Sex development malformative disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2A	CHRFAM7A,CHRNA7
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	CHRFAM7A,CHRNA7
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CHRNA7,CHRFAM7A
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	CHRNA7,CHRFAM7A
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CHRNA7,CHRFAM7A
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	CHRFAM7A,CHRNA7
Mental/behavioural/neurodevelopmental disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6E20-6E8Z	CHRNA7,CHRFAM7A
Adaptive immunity immunodeficiency Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A01	CHRFAM7A,CHRNA7
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	CHRFAM7A,CHRNA7
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	CHRNA7,CHRFAM7A
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CHRFAM7A,CHRNA7
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CHRNA4,CHRNA7
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CHRNA4,CHRNA7
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	CHRNA4
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	CHRNA4
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	CHRNA4
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	CHRNA4
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	CHRNA4
Hypertensive crisis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA03	CHRNA4
Aneurysm/dissection Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD50	CHRNA4
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CHRNA4
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CHRNA7
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CHRNA7
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CHRNA7
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	CHRNA4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CHRNA7
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	CHRNA7
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CHRNA4
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CHRNA4

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Alangium Chinense

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

21 All known Ingredients in Total

21 Ingredients with Acceptable Bioavailablity

17 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Depression

Corneal disease

Alzheimer disease

Nicotine use disorder

Sex development malformative disorder

Dissociative neurological symptom disorder

Schizophrenia

Sexual dysfunction

Breast cancer

General pain disorder

Mental/behavioural/neurodevelopmental disorder

Adaptive immunity immunodeficiency

Mild neurocognitive disorder

Parkinsonism

Asthma

Cytomegaloviral disease

Malignant neoplasms of adrenal gland

Hypotension

Attention deficit hyperactivity disorder

Digestive system disease

Irritable bowel syndrome

Mood disorder

Hypertensive crisis

Aneurysm/dissection

Carcinosarcoma of uterus

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Idiopathic pulmonary fibrosis

Squamous cell carcinoma of bronchus or lung

Melanoma of skin

Chikungunya virus disease

Invasive carcinoma of breast

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities