CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Dysoxylum Binectariferum

Example Image

PLANiTS DNA barcode

ATCGTTGCCCCCCCAAAAAAAAACCCTCCCGGGGGATCGTTGGGCGGGCGGAAAATGGCCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATTTGAGTCCTCGGCGACCTTGCCGCGACGATCGGTGGTGAGAATAGACCCTCGAGCTGCAGTCGCGTGCTCGTGTCCTCGTGTTATGGGCTTGCGTACCCTTTCCAGCGCCTTCTACCCGTGGCGCTGCTCGCT

Taxonomic Information

Plant ID: NPO15933
Plant Latin Name: Dysoxylum Binectariferum
Taxonomy Genus: Dysoxylum
Taxonomy Family: Meliaceae

Plant External Links:

NCBI TaxonomyDB: 693285
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC86789

Ingredient ID: NPC67033

Ingredient ID: NPC52963

Ingredient ID: NPC37726

Ingredient ID: NPC282908

Ingredient ID: NPC264938

Ingredient ID: NPC263732

Ingredient ID: NPC239049

Ingredient ID: NPC139548

Ingredient ID: NPC129578

Ingredient ID: NPC122362

Ingredient ID: NPC111031

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Protein Kinase	CDK4	Cyclin-dependent kinase 4	P11802	CHEMBL331
Therapeutic Target	Protein Kinase	PRKCD	Protein kinase C delta	Q05655	CHEMBL2996
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Protein Kinase	CDK2	Cyclin-dependent kinase 2	P24941	CHEMBL301
Therapeutic Target	Protein Kinase	CDK6	Cyclin-dependent kinase 6	Q00534	CHEMBL2508
Therapeutic Target	Protein Kinase	CDK9	Cyclin-dependent kinase 9	P50750	CHEMBL3116
Therapeutic Target	Protein Kinase	CDK7	Cyclin-dependent kinase 7	P50613	CHEMBL3055
Therapeutic Target	Protein Kinase	PRKCE	Protein kinase C epsilon	Q02156	CHEMBL3582
Therapeutic Target	Protein Kinase	CDK5	Cyclin-dependent kinase 5	Q00535	CHEMBL4036

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	40

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00016939	Flavopiridol in Treating Patients With Unresectable or Metastatic Kidney Cancer	kidney cancer	Alvocidib (NPC264938)	NP level
NCT00003039	Flavopiridol in Treating Patients With Recurrent Intermediate-Grade or High-Grade Non-Hodgkin's Lymphoma or Mantle Cell Lymphoma	lymphoma	Alvocidib (NPC264938)	NP level
NCT00016185	Flavopiridol and Docetaxel in Treating Patients With Advanced Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00098371	Flavopiridol in Treating Patients With Chronic Lymphocytic Leukemia or Prolymphocytic Leukemia	chronic lymphocytic leukemia;prolymphocytic leukemia	Alvocidib (NPC264938)	NP level
NCT03298984	Ph I Study of Alvocidib and Cytarabine/Daunorubicin (7+3) in Patients With Newly Diagnosed Acute Myeloid Leukemia (AML).	acute myeloid leukemia	Alvocidib (NPC264938)	NP level
NCT00445341	Flavopiridol to Treat Relapsed Mantle Cell Lymphoma or Diffuse Large B-Cell Lymphoma	lymphoma	Alvocidib (NPC264938)	NP level
NCT00080990	Alvocidib, Oxaliplatin, Fluorouracil, and Leucovorin Calcium in Treating Patients With Advanced Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00070239	Alvocidib in Treating Patients With Metastatic or Unresectable Refractory Solid Tumors or Hematologic Malignancies	lymphoid neoplasm	Alvocidib (NPC264938)	NP level
NCT00045448	Combination Chemotherapy in Treating Patients With Advanced Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00324480	Vorinostat and Alvocidib in Treating Patients With Advanced Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00003620	Flavopiridol in Treating Patients With Chronic Lymphocytic Leukemia	chronic lymphocytic leukemia	Alvocidib (NPC264938)	NP level
NCT02520011	Alvocidib Biomarker-driven Phase 2 AML Study	acute myeloid leukemia	Alvocidib (NPC264938)	NP level
NCT00007917	Gemcitabine Plus Flavopiridol in Treating Patients With Advanced Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00039455	Trastuzumab and Flavopiridol in Treating Patients With Metastatic Breast Cancer	male breast carcinoma	Alvocidib (NPC264938)	NP level
NCT00079352	Flavopiridol, Gemcitabine, and Irinotecan in Treating Patients With Unresectable or Metastatic Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00464633	Alvocidib in Patients With Previously Treated Chronic Lymphocytic Leukemia or Prolymphocytic Leukemia Arising From Chronic Lymphocytic Leukemia (CLL)	chronic lymphocytic leukemia	Alvocidib (NPC264938)	NP level
NCT00005074	Flavopiridol in Treating Patients With Previously Untreated or Relapsed Mantle Cell Lymphoma	lymphoma	Alvocidib (NPC264938)	NP level
NCT00021073	Combination Chemotherapy in Treating Patients With Advanced Cancer	neoplasm	Alvocidib (NPC264938)	NP level
NCT00019344	Flavopiridol in Treating Patients With Refractory Cancer	lymphoma;prostate cancer	Alvocidib (NPC264938)	NP level
NCT00005974	Flavopiridol in Treating Patients With Recurrent, Locally Advanced, or Metastatic Soft Tissue Sarcoma	sarcoma	Alvocidib (NPC264938)	NP level
NCT00003256	Flavopiridol in Treating Patients With Recurrent Prostate Cancer	prostate cancer	Alvocidib (NPC264938)	NP level
NCT00047203	Flavopiridol in Treating Patients With Relapsed or Refractory Multiple Myeloma	multiple myeloma	Alvocidib (NPC264938)	NP level
NCT00377104	Alvocidib in Treating Patients With B-Cell Chronic Lymphocytic Leukemia or Small Lymphocytic Lymphoma	chronic lymphocytic leukemia	Alvocidib (NPC264938)	NP level
NCT00005971	Flavopiridol in Treating Patients With Metastatic Malignant Melanoma	cutaneous melanoma	Alvocidib (NPC264938)	NP level
NCT00006485	Flavopiridol and Irinotecan in Treating Patients With Advanced Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00058240	Flavopiridol in Treating Patients With Previously Treated Chronic Lymphocytic Leukemia or Lymphocytic Lymphoma	chronic lymphocytic leukemia	Alvocidib (NPC264938)	NP level
NCT00020332	Docetaxel and Flavopiridol in Treating Patients With Locally Advanced or Metastatic Breast Cancer	breast cancer	Alvocidib (NPC264938)	NP level
NCT00112684	Alvocidib in Treating Patients With Locally Advanced or Metastatic Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00003690	Flavopiridol Plus Cisplatin or Carboplatin in Treating Patients With Advanced Solid Tumors	breast cancer;cutaneous melanoma;prostate cancer	Alvocidib (NPC264938)	NP level
NCT00072436	Gemcitabine Hydrochloride and Alvocidib in Treating Patients With Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT03441555	A Study of Venetoclax and Alvocidib in Patients With Relapsed/Refractory Acute Myeloid Leukemia	acute myeloid leukemia	Alvocidib (NPC264938)	NP level
NCT00003004	Combination Chemotherapy in Treating Patients With Refractory or Recurrent Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00064285	Flavopiridol and Imatinib Mesylate in Treating Patients With Hematologic Cancer	leukemia	Alvocidib (NPC264938)	NP level
NCT00046917	Combination Chemotherapy in Treating Patients With Advanced Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT00087282	Irinotecan and Flavopiridol in Treating Patients With Advanced Liver Cancer	liver cancer	Alvocidib (NPC264938)	NP level
NCT03563560	A Study of DSP-2033 (Alvocidib) in Patients With Acute Myeloid Leukemia	acute myeloid leukemia	Alvocidib (NPC264938)	NP level
NCT00006245	Flavopiridol and Paclitaxel in Treating Patients With Locally Advanced or Metastatic Esophageal Cancer That Has Not Responded to Previous Paclitaxel	esophageal cancer	Alvocidib (NPC264938)	NP level
NCT00042874	Combination Chemotherapy in Treating Patients With Locally Advanced or Metastatic Solid Tumors	neoplasm	Alvocidib (NPC264938)	NP level
NCT03969420	Study of Alvocidib in Patients With Relapsed/Refractory AML Following Treatment With Venetoclax Combination Therapy	acute myeloid leukemia	Alvocidib (NPC264938)	NP level
NCT00023894	Flavopiridol in Treating Patients With Recurrent or Persistent Endometrial Cancer	endometrial cancer	Alvocidib (NPC264938)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CDK5,CDK2,CCNE2,CCNA2,CDK6,CCNA1,CDK4,CDK1,CCND1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	CDK9,GSK3B,PYGM NCT03563560,NCT03441555,NCT02520011,NCT03298984,NCT03969420
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CDK2,CDK1,GSK3B,CDK9,CDK6,CDK7,CDK4,CCND1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CDK5R1,CDK5,CCNE2,CCNA2,CCND1,CDK6,CCNA1,CDK4
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CDK5R1,CCND2,CCNA2,CDK6,CCNB1,CDK1,CCNB2,CDK4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CDK5R1,CCNE2,CCNA2,CCNA1,CCNB1,CDK1,CCNB2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CDK5R1,CDK5,CCNE2,CCNA2,CCNA1,CDK7,CCND1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CCNE2,CCNA2,CCND1,CCNB1,CDK1,CCNB2,CDK4
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CDK6,CDK1,CDK2,CDK4 NCT00003690,NCT00020332
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CDK2,CDK9 NCT00445341,NCT00019344,NCT00003039,NCT00005074
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	PRKCD,CCNE2,CCNA2,CCNA1,PRKCE,CCND1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CCND2,CCNA2,CCNB2,CCNB2,CCNA2,CCND1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CDK5R1,CDK5,PRKCD,CCNA2,CCNA1,CCND1
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CCNA2,CCNA1,CCNB1,CDK1,CCNB2,CCND1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CDK5R1,CCNE2,CCNA2,CCNB1,CDK1,CCNB2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CCNE2,CCNA2,CCNA1,CCNB1,CDK1,CCNB2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CDK2,MNAT1,CDK6,CCNB1,CDK1,CCND1
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	CDK1,CDK2,CDK4,CDK7,CDK9
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDK1,CDK6,CDK2,CDK4,CDK7
Chronic lymphocytic leukaemia or small lymphocytic lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82.0	NCT00058240,NCT00464633,NCT00003620,NCT00098371,NCT00377104
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CCNA2,CDK6,CCNB1,CDK1,CCNB2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CCNE2,CCNA2,CCNB1,CDK1,CCNB2
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CCNE2,CCNA2,CCNB1,CDK1,CCNB2
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	CDK4 NCT00003690,NCT00019344,NCT00003256
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CDK5R1,CCNA1,PRKCE,CCND1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	CCNE2,CDK6,CCNA1,CCND1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CCNB1,CDK1,CCNB2,CCNA2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CCND2,CCNE2,CCNA2,CCND1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CDK5R1,PRKCD,CCNB2,CCNA2
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDK2,CDK1,CDK7
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	CDK4,CDK2,CDK6
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	CDK4,CDK1,CDK9
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	CCND1,CDK9,PYGM
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CDK1,CDK6,CCND1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CCNA1,PRKCE,CCND1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	CDK4,CDK6
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	CCND1,GSK3B
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CDK6,CDK4
Melanoma of skin, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30.Z	NCT00005971,NCT00003690
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CCNB1,CDK1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CDK2,CDK4
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CDK5R1,CCNA1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CCNA1,CCND1
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	CCNB1,CDK2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CCND2,CDK5R1,CDK5,CDK7,CDK2,CCNE2,MNAT1,CCNA2,CCND1,CDK6,CCNB1,CDK1,CCNB2,LARP7,CDK4
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT00079352,NCT00080990,NCT00324480,NCT00045448,NCT00112684,NCT00072436,NCT00016185,NCT00003004,NCT00007917,NCT00006485,NCT00021073,NCT00042874,NCT00046917
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CDK5R1,CCNE2,CCNA2,CCNB1,CDK1,CCNB2,CCNE2,CCNA2,CCNB1,CDK1,CCNB2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CDK5R1,CCND2,PRKCD,CDK7,CCNE2,CCNA2,CCNB1,CDK1,CCNB2,CDK4
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	GSK3B
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	PRKCD
Liver vascular disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB98	PRKCE
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	CDK4
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	PRKCE
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	GSK3B
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	PRKCE
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PRKCE
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDK2
Thymoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CDK2
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	PYGM
Malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	NCT00016939
Carcinoma of male breast Disease Category: X.Extension Codes Disease ICD-11 Code: XH5KW8	NCT00039455
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	NCT00005974
Neoplasms of haematopoietic or lymphoid tissues, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B3Z	NCT00070239
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	NCT00047203
Prolymphocytic leukaemia, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH8TD6	NCT00098371
Leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60-2B33	NCT00064285
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	NCT00023894
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	NCT00006245
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	NCT00087282
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CCND2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CCNA1
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	PRKCE
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CCND1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CCNA1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	CDK6
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CCNA1
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	CCND1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	PYGM

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Dysoxylum Binectariferum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

12 All known Ingredients in Total

9 Ingredients with Acceptable Bioavailablity

5 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Mesothelioma of pleura

Acute myeloid leukaemia

Solid tumour/cancer

Carcinosarcoma of uterus

Hepatoblastoma

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of thymus

Malignant neoplasms of adrenal gland

Breast cancer

Mature T-cell lymphoma

Serous cystadenoma,borderline malignancy of ovary

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of pancreas

Malignant neoplasms of oesophagus

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Germ cell tumour of testis

Malignant haematopoietic neoplasm

Lung cancer

Chronic lymphocytic leukaemia or small lymphocytic lymphoma

Adenocarcinoma of stomach

Urothelial carcinoma of bladder

Invasive carcinoma of breast

Prostate cancer

Pheochromocytoma

Melanoma of skin

Other specified malignant neoplasms of bronchus or lung

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Nasopharyngeal cancer

Brain cancer

Mature B-cell lymphoma

Mature B-cell leukaemia

Osteoarthritis, unspecified

West Nile virus infection

Psoriasis

Myeloproliferative neoplasm

Schizophrenia

Melanoma of skin, unspecified

Coeliac disease

Superficial ovarian endometriosis

Cytomegaloviral disease

Malignant neoplasms of thyroid gland, unspecified

Gliomas of brain

Diffuse large B-cell lymphomas

Neoplasms

Hepatocellular carcinoma of liver

Malignant neoplasms of biliary tract, distal bile duct

Fragile X chromosome

Osteosarcoma

Myocardial infarction

Liver vascular disorder

Liposarcoma

Anxiety

Parkinsonism

Malaria

Alzheimer disease

Myotonic disorder

Non-small cell lung cancer

Thymoma

Metabolic disorder

Malignant neoplasms of kidney, except renal pelvis

Carcinoma of male breast

Pleomorphic sarcoma