• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Stachys Mucronata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCAAAGCAGACCGCGAACACGTTCAAAACAACCGCGGCGCCGCGGAGCGGGGGCGACCCCGCGAAGCGGCCCCGACCCCGCCGGCGCTCGCGCCGCGCGGGCTAACGAACTCGGGCGCGGAATGCGCCAAGGAAAACGAAATGGAGCGTTCCCCCTCCCGACGCCGCCCCGTCCGCGGGGCGACGGGAGAGTGTGGACGCCTATCGAATGTCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO15872
Plant Latin Name: Stachys Mucronata
Taxonomy Genus: Stachys
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 1391974
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

26 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC90672

Ingredient ID: NPC79253

Ingredient ID: NPC72529

Ingredient ID: NPC70718

Ingredient ID: NPC65766

Ingredient ID: NPC63227

Ingredient ID: NPC59844

Ingredient ID: NPC32364

Ingredient ID: NPC289315

Ingredient ID: NPC263441

Ingredient ID: NPC249352

Ingredient ID: NPC231018

Ingredient ID: NPC220786

Ingredient ID: NPC214729

Ingredient ID: NPC199537

Ingredient ID: NPC195848

Ingredient ID: NPC192582

Ingredient ID: NPC192040

Ingredient ID: NPC174265

Ingredient ID: NPC172595

Ingredient ID: NPC154078

Ingredient ID: NPC150822

Ingredient ID: NPC149184

Ingredient ID: NPC142415

Ingredient ID: NPC140291

Ingredient ID: NPC127853