CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Stachys Mucronata

Example Image

PLANiTS DNA barcode

TCGAAACCTGCAAAGCAGACCGCGAACACGTTCAAAACAACCGCGGCGCCGCGGAGCGGGGGCGACCCCGCGAAGCGGCCCCGACCCCGCCGGCGCTCGCGCCGCGCGGGCTAACGAACTCGGGCGCGGAATGCGCCAAGGAAAACGAAATGGAGCGTTCCCCCTCCCGACGCCGCCCCGTCCGCGGGGCGACGGGAGAGTGTGGACGCCTATCGAATGTCTAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO15872
Plant Latin Name: Stachys Mucronata
Taxonomy Genus: Stachys
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 1391974
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

26 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC90672

Ingredient ID: NPC79253

Ingredient ID: NPC72529

Ingredient ID: NPC70718

Ingredient ID: NPC65766

Ingredient ID: NPC63227

Ingredient ID: NPC59844

Ingredient ID: NPC32364

Ingredient ID: NPC289315

Ingredient ID: NPC263441

Ingredient ID: NPC249352

Ingredient ID: NPC231018

Ingredient ID: NPC220786

Ingredient ID: NPC214729

Ingredient ID: NPC199537

Ingredient ID: NPC195848

Ingredient ID: NPC192582

Ingredient ID: NPC192040

Ingredient ID: NPC174265

Ingredient ID: NPC172595

Ingredient ID: NPC154078

Ingredient ID: NPC150822

Ingredient ID: NPC149184

Ingredient ID: NPC142415

Ingredient ID: NPC140291

Ingredient ID: NPC127853

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CDC25B,CES1,AKR1B10,PTPRC,PTPN1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CDC25B,PTPN1,AKR1B10
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CDC25B,PTPRC,AKR1B10
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1B10,CDC25B,AKR1B10
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	PTPRC,AKR1B10
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	F3,PTPN1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	AKR1B10,PTPRC
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	PTPRC,AKR1B10
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	PTPRC,AKR1B10
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CDC25B,PTPRC
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	PTPRC
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	PTPRC
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	F3
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	PTPRC
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDC25B
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	F3
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	PTPN1
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTPN1
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PTPRC
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	PTPN1
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPRC
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	PTPRC
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PTPN1
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	PTPN1
Ophthalmic devices/implants/grafts injury Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PK97	PTPN1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PTPN1
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDC25B
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	PTPRC
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	AKR1B10
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	F3
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	AKR1B10
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B10
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDC25B
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1B10
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CDC25B
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	PTPRC
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1B10
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CDC25B
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	F3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1B10
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	AKR1B10
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	F3
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Stachys Mucronata

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

26 All known Ingredients in Total

13 Ingredients with Acceptable Bioavailablity

8 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Leishmaniasis

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Malignant neoplasms of thymus

Glioblastoma of brain

Germ cell tumour of testis

Malignant haematopoietic neoplasm

Bleeding disorder

Acute myeloid leukaemia

Solid tumour/cancer

Mature T-cell lymphoma

Lung cancer

Pancreatic cancer

Breast cancer

Synthesis disorder

Postoperative inflammation

Transplant rejection

Hyper-lipoproteinaemia

Acute respiratory distress syndrome

Chronic arterial occlusive disease

Obesity

Diffuse large B-cell lymphoma

Transplanted organ/tissue

Acute diabete complication

Metabolic disorder

Ophthalmic devices/implants/grafts injury

Type 2 diabetes mellitus

Nasopharyngeal cancer

Peroxisomal disease

BCR-ABL1-negative chronic myeloid leukaemia

Carcinosarcoma of uterus

Malignant neoplasms of biliary tract, distal bile duct

Psoriasis

Hepatoblastoma

Adenocarcinoma of stomach

Squamous cell carcinoma of bronchus or lung

Tetralogy of Fallot

Other specified malignant neoplasms ofcolon

Melanoma of skin

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of oesophagus

Systemic lupus erythematosus

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Gliomas of brain

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities