• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Veratrum Nigrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGATCATTGCTGAGACCCCCAACATTAACGTATGACTTGCGAACTTGTGAATGATAGTGACAACTTGCGCCATCGTGTTGATGTTGTTGCGGATGGTTCGTGACCGTGTCAACATGTTGGTGTGGGTTGGAACACCAACGAACTCCGGCACAGTCGTGTGTCAAGGACGAAATAATTACCGAAAATGACAATGCCCTTTCCTCGAGCATTGCTTTCGAGATTTGGGTCCATCGTCATGTTGTGAAGAATTGGATGACTCTCGACAACGGATATCTGGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTNNNNNNNNNNNNNAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGATGCCATTTGGTGGAGGGCACATCTGCCTGTGTGTCACGTTTCGTGTTTGCTCCTCGCCTTTTGTGCCCCGCTCTATTGCGATGCTAGAGGTGTTGGATGCAAAGTTTGGCTCCTCGTGCCCTTGTGCGCGTTGGGCTGAAGATTGGGTTGCCGGCATGGAAGAGTATGGCTAATGGTTGATGCTTTGTCGCATAAATGCTTATTGTTGTGCTCTCATTGCCCAAGCATATGTTGACCCTTGAGACCCAAATTGCGATCGTCTTGCCTTGCTCGACGCTTTGCATAGCGACCTCAGG

Click for details-----ITS1

NA

Click for details-----ITS2

TTCGTGTTTGCTCCTCGCCTCTTGTGCCCAGCTCTATTGCGATGCTAAGAGGCGTTGGATGCAAAGTTTGGCTCCTCGTGCCCTTGTGCGCGTTGGGCTGAAGATTGGGTTGTCGGCACTGAAGAGCATAGCTAATGGTTGATGCTTTGTTGCAGAAATGGTTATTGTTGTGCTCTCATTGCCCACGCATTTGTTGACCCTTGAGACCCAAATTGCGATCGTCTTGCCTTGCTGGACGCCTTGCATAGAGACCTCAGG
Taxonomic Information

Plant ID: NPO15848
Plant Latin Name: Veratrum Nigrum
Taxonomy Genus: Veratrum
Taxonomy Family: Melanthiaceae

Plant External Links:

NCBI TaxonomyDB: 203100
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Italy

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Anthelmintic; Emetic; Errhine; Expectorant; Laxative; Vermifuge

Geographical Distribution

Italy; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

89 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98419

Ingredient ID: NPC97907

Ingredient ID: NPC96010

Ingredient ID: NPC94982

Ingredient ID: NPC94687

Ingredient ID: NPC94644

Ingredient ID: NPC93341

Ingredient ID: NPC91603

Ingredient ID: NPC85505

Ingredient ID: NPC78994

Ingredient ID: NPC77464

Ingredient ID: NPC74637

Ingredient ID: NPC73486

Ingredient ID: NPC7283

Ingredient ID: NPC70245

Ingredient ID: NPC69096

Ingredient ID: NPC68089

Ingredient ID: NPC60950

Ingredient ID: NPC6048

Ingredient ID: NPC59930

Ingredient ID: NPC59272

Ingredient ID: NPC57669

Ingredient ID: NPC54962

Ingredient ID: NPC5440

Ingredient ID: NPC49780

Ingredient ID: NPC48886

Ingredient ID: NPC478140

Ingredient ID: NPC478139

Ingredient ID: NPC478138

Ingredient ID: NPC478137

Ingredient ID: NPC478136

Ingredient ID: NPC47762

Ingredient ID: NPC47565

Ingredient ID: NPC46981

Ingredient ID: NPC4558

Ingredient ID: NPC42648

Ingredient ID: NPC40488

Ingredient ID: NPC322786

Ingredient ID: NPC320655

Ingredient ID: NPC31870

Ingredient ID: NPC317654

Ingredient ID: NPC311407

Ingredient ID: NPC310582

Ingredient ID: NPC309870

Ingredient ID: NPC309249

Ingredient ID: NPC308250

Ingredient ID: NPC304646

Ingredient ID: NPC304218

Ingredient ID: NPC294262

Ingredient ID: NPC292838

Ingredient ID: NPC289588

Ingredient ID: NPC288391

Ingredient ID: NPC269235

Ingredient ID: NPC266562

Ingredient ID: NPC264179

Ingredient ID: NPC250255

Ingredient ID: NPC247219

Ingredient ID: NPC242223

Ingredient ID: NPC241679

Ingredient ID: NPC235948

Ingredient ID: NPC230232

Ingredient ID: NPC229900

Ingredient ID: NPC226941

Ingredient ID: NPC219475

Ingredient ID: NPC219372

Ingredient ID: NPC198091

Ingredient ID: NPC197966

Ingredient ID: NPC196368

Ingredient ID: NPC195400

Ingredient ID: NPC192204

Ingredient ID: NPC184610

Ingredient ID: NPC183353

Ingredient ID: NPC173572

Ingredient ID: NPC173016

Ingredient ID: NPC172769

Ingredient ID: NPC170880

Ingredient ID: NPC165713

Ingredient ID: NPC15528

Ingredient ID: NPC152665

Ingredient ID: NPC149686

Ingredient ID: NPC147479

Ingredient ID: NPC146163

Ingredient ID: NPC14005

Ingredient ID: NPC138631

Ingredient ID: NPC131302

Ingredient ID: NPC127454

Ingredient ID: NPC122814

Ingredient ID: NPC110560

Ingredient ID: NPC106059